Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1208054501:

Variant ID: vg1208054501 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 8054501
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.64, C: 0.37, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:


GTGGAGGTCATCTCAATCGGGCCTAACTTCGAGCCCGTCACAGATGAGTGTCATCGGTGACGGGCTATAGGAATATGCATCCCGACGAGTACATATACAA[T/C]
GGCAAAAATTTAGGCCCGATTGAGATGACTTCGTTCTGACGGCCCACGTTGTCCAGGCATGTGATGGGCCGTCACAGATGAGAGGATCTGTACTAGTGAT

Reverse complement sequence

ATCACTAGTACAGATCCTCTCATCTGTGACGGCCCATCACATGCCTGGACAACGTGGGCCGTCAGAACGAAGTCATCTCAATCGGGCCTAAATTTTTGCC[A/G]
TTGTATATGTACTCGTCGGGATGCATATTCCTATAGCCCGTCACCGATGACACTCATCTGTGACGGGCTCGAAGTTAGGCCCGATTGAGATGACCTCCAC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 37.70% 36.70% 0.49% 25.03% NA
All Indica  2759 36.40% 48.40% 0.51% 14.68% NA
All Japonica  1512 47.80% 2.20% 0.60% 49.47% NA
Aus  269 1.90% 97.00% 0.00% 1.12% NA
Indica I  595 51.90% 31.90% 0.50% 15.63% NA
Indica II  465 52.90% 39.40% 0.22% 7.53% NA
Indica III  913 19.50% 63.40% 0.66% 16.43% NA
Indica Intermediate  786 34.50% 48.90% 0.51% 16.16% NA
Temperate Japonica  767 75.00% 0.80% 0.52% 23.73% NA
Tropical Japonica  504 15.70% 4.20% 0.79% 79.37% NA
Japonica Intermediate  241 28.20% 2.50% 0.41% 68.88% NA
VI/Aromatic  96 19.80% 74.00% 0.00% 6.25% NA
Intermediate  90 37.80% 38.90% 0.00% 23.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1208054501 T -> C LOC_Os12g14180.1 intron_variant ; MODIFIER silent_mutation Average:55.113; most accessible tissue: Minghui63 young leaf, score: 75.479 N N N N
vg1208054501 T -> DEL N N silent_mutation Average:55.113; most accessible tissue: Minghui63 young leaf, score: 75.479 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1208054501 NA 3.65E-12 Heading_date All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1208054501 NA 2.88E-10 Heading_date Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1208054501 NA 2.34E-24 Plant_height All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1208054501 7.11E-07 4.88E-17 mr1002 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208054501 NA 4.48E-07 mr1002 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208054501 NA 1.21E-11 mr1002 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208054501 NA 8.18E-07 mr1013 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208054501 NA 2.50E-08 mr1031 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208054501 NA 5.51E-06 mr1034 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208054501 NA 3.58E-07 mr1056 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208054501 NA 1.18E-06 mr1163 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208054501 NA 5.07E-06 mr1425 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208054501 NA 6.26E-09 mr1425 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208054501 NA 8.01E-06 mr1558 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208054501 NA 1.99E-06 mr1942 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208054501 2.29E-10 1.86E-21 mr1002_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208054501 NA 1.25E-08 mr1002_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208054501 2.13E-06 6.89E-18 mr1002_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208054501 NA 1.86E-08 mr1010_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208054501 NA 4.56E-10 mr1011_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208054501 NA 2.25E-09 mr1013_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208054501 NA 9.09E-12 mr1031_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208054501 NA 6.02E-06 mr1060_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208054501 NA 2.07E-06 mr1186_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208054501 NA 3.44E-06 mr1265_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208054501 NA 7.36E-06 mr1268_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208054501 4.52E-06 1.52E-08 mr1296_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208054501 NA 1.79E-06 mr1296_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208054501 NA 1.56E-07 mr1359_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208054501 NA 7.88E-09 mr1378_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208054501 NA 2.64E-07 mr1378_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208054501 NA 8.09E-07 mr1428_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208054501 NA 3.17E-06 mr1452_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208054501 NA 6.02E-07 mr1452_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208054501 NA 2.46E-07 mr1539_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208054501 1.42E-06 NA mr1540_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208054501 9.04E-06 2.71E-10 mr1540_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208054501 NA 9.79E-06 mr1558_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208054501 NA 1.68E-08 mr1563_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208054501 NA 1.60E-10 mr1576_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208054501 NA 1.28E-07 mr1576_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208054501 NA 7.86E-08 mr1582_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208054501 NA 2.89E-09 mr1627_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208054501 2.84E-06 NA mr1732_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208054501 NA 1.27E-09 mr1732_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208054501 NA 3.42E-09 mr1815_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208054501 NA 8.62E-06 mr1815_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208054501 NA 1.78E-10 mr1864_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208054501 NA 9.75E-07 mr1865_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208054501 NA 7.10E-06 mr1870_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208054501 NA 9.97E-07 mr1882_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208054501 NA 3.12E-06 mr1902_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208054501 NA 2.49E-07 mr1977_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208054501 NA 1.71E-06 mr1994_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1208054501 NA 8.20E-06 mr1994_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251