\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1206807863:

Variant ID: vg1206807863 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 6807863
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GATGGGAGCACAATAAAGCTGTGTTCGGCACCCCTTTTCCCGATCCATCTCCCTCGTCTATCGTACTCATGCCTTTTAAACTGCTAAACAGTGTGTTTTT[G/A]
CAAAAATTTTCTATACGAAAGTTACTTAAAAATCAAATTAATCTATTTTTGAAAAAAAATAGCTAATACTTAATTAATCACGCGCTAATAGACTGTTCTA

Reverse complement sequence

TAGAACAGTCTATTAGCGCGTGATTAATTAAGTATTAGCTATTTTTTTTCAAAAATAGATTAATTTGATTTTTAAGTAACTTTCGTATAGAAAATTTTTG[C/T]
AAAAACACACTGTTTAGCAGTTTAAAAGGCATGAGTACGATAGACGAGGGAGATGGATCGGGAAAAGGGGTGCCGAACACAGCTTTATTGTGCTCCCATC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 69.40% 30.50% 0.08% 0.00% NA
All Indica  2759 93.10% 6.80% 0.07% 0.00% NA
All Japonica  1512 26.30% 73.60% 0.07% 0.00% NA
Aus  269 72.10% 27.90% 0.00% 0.00% NA
Indica I  595 88.90% 11.10% 0.00% 0.00% NA
Indica II  465 97.00% 3.00% 0.00% 0.00% NA
Indica III  913 95.50% 4.40% 0.11% 0.00% NA
Indica Intermediate  786 91.20% 8.70% 0.13% 0.00% NA
Temperate Japonica  767 33.90% 66.10% 0.00% 0.00% NA
Tropical Japonica  504 7.30% 92.50% 0.20% 0.00% NA
Japonica Intermediate  241 41.90% 58.10% 0.00% 0.00% NA
VI/Aromatic  96 82.30% 17.70% 0.00% 0.00% NA
Intermediate  90 45.60% 53.30% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1206807863 G -> A LOC_Os12g12360.1 upstream_gene_variant ; 886.0bp to feature; MODIFIER silent_mutation Average:64.547; most accessible tissue: Minghui63 flag leaf, score: 80.241 N N N N
vg1206807863 G -> A LOC_Os12g12370.1 upstream_gene_variant ; 3355.0bp to feature; MODIFIER silent_mutation Average:64.547; most accessible tissue: Minghui63 flag leaf, score: 80.241 N N N N
vg1206807863 G -> A LOC_Os12g12360.2 upstream_gene_variant ; 886.0bp to feature; MODIFIER silent_mutation Average:64.547; most accessible tissue: Minghui63 flag leaf, score: 80.241 N N N N
vg1206807863 G -> A LOC_Os12g12360-LOC_Os12g12370 intergenic_region ; MODIFIER silent_mutation Average:64.547; most accessible tissue: Minghui63 flag leaf, score: 80.241 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1206807863 5.47E-06 NA Heading_date All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1206807863 NA 1.15E-07 mr1024_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206807863 3.95E-06 NA mr1489_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251