\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1206434711:

Variant ID: vg1206434711 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 6434711
Reference Allele: CAlternative Allele: A
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.74, C: 0.26, others allele: 0.00, population size: 76. )

Flanking Sequence (100 bp) in Reference Genome:


GTCTCGGTTTTTGTTGCAACCGGGACTATTATGGAATTTGGTCGACCGACCTGATGAGGACATAACTAGCTCGGATATGACCATGACTACTTTATATATT[C/A]
ATCAACCAAAGGTGCATATATTCTATGTTAGATTTACTTATTATATATTTGAACAAACGTTGCTATACAATGAGTTTCGTGTGTTTTCGTGTGTCTTCTC

Reverse complement sequence

GAGAAGACACACGAAAACACACGAAACTCATTGTATAGCAACGTTTGTTCAAATATATAATAAGTAAATCTAACATAGAATATATGCACCTTTGGTTGAT[G/T]
AATATATAAAGTAGTCATGGTCATATCCGAGCTAGTTATGTCCTCATCAGGTCGGTCGACCAAATTCCATAATAGTCCCGGTTGCAACAAAAACCGAGAC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 25.30% 19.50% 1.40% 53.85% NA
All Indica  2759 36.60% 12.30% 1.23% 49.87% NA
All Japonica  1512 5.70% 32.30% 1.65% 60.38% NA
Aus  269 1.90% 22.30% 1.49% 74.35% NA
Indica I  595 86.60% 5.50% 0.34% 7.56% NA
Indica II  465 20.90% 26.50% 1.29% 51.40% NA
Indica III  913 11.30% 8.30% 2.08% 78.31% NA
Indica Intermediate  786 37.70% 13.50% 0.89% 47.96% NA
Temperate Japonica  767 8.60% 41.10% 1.96% 48.37% NA
Tropical Japonica  504 2.40% 13.10% 1.39% 83.13% NA
Japonica Intermediate  241 3.30% 44.40% 1.24% 51.04% NA
VI/Aromatic  96 68.80% 11.50% 0.00% 19.79% NA
Intermediate  90 30.00% 25.60% 3.33% 41.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1206434711 C -> DEL N N silent_mutation Average:31.864; most accessible tissue: Zhenshan97 flag leaf, score: 46.427 N N N N
vg1206434711 C -> A LOC_Os12g11840.1 downstream_gene_variant ; 4919.0bp to feature; MODIFIER silent_mutation Average:31.864; most accessible tissue: Zhenshan97 flag leaf, score: 46.427 N N N N
vg1206434711 C -> A LOC_Os12g11840-LOC_Os12g11860 intergenic_region ; MODIFIER silent_mutation Average:31.864; most accessible tissue: Zhenshan97 flag leaf, score: 46.427 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1206434711 2.27E-06 2.27E-06 mr1173 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206434711 8.43E-06 8.51E-06 mr1381 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206434711 4.47E-08 4.47E-08 mr1381 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206434711 4.88E-06 4.88E-06 mr1572 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206434711 NA 7.26E-08 mr1030_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206434711 NA 6.55E-06 mr1289_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206434711 NA 5.29E-06 mr1329_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206434711 NA 1.37E-06 mr1524_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206434711 1.98E-06 NA mr1549_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206434711 NA 5.69E-08 mr1683_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206434711 NA 1.75E-06 mr1687_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206434711 NA 1.45E-07 mr1749_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206434711 NA 1.04E-08 mr1821_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1206434711 NA 8.76E-06 mr1923_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251