| Variant ID: vg1204426116 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 4426116 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TTGGGTATTACGTTTCCTTGTATATCACGGAACGGCCTAAAGTCCTGGTTTGATAAGATTGTAAAGTAGATTTAGGAAACCGATACCGTATTGGATAAGG[A/T]
TTCTATCTTGTAATCCTGCCCCCCCTCCTATATAAGGTGGGCAGGAGGCCCTCTAGGGGGCATGACACAACCTGATCGTCAGATCAATACTACACCCGGC
GCCGGGTGTAGTATTGATCTGACGATCAGGTTGTGTCATGCCCCCTAGAGGGCCTCCTGCCCACCTTATATAGGAGGGGGGGCAGGATTACAAGATAGAA[T/A]
CCTTATCCAATACGGTATCGGTTTCCTAAATCTACTTTACAATCTTATCAAACCAGGACTTTAGGCCGTTCCGTGATATACAAGGAAACGTAATACCCAA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 21.20% | 1.10% | 5.50% | 72.15% | NA |
| All Indica | 2759 | 2.90% | 1.00% | 5.62% | 90.43% | NA |
| All Japonica | 1512 | 55.30% | 0.10% | 0.53% | 44.11% | NA |
| Aus | 269 | 14.90% | 5.60% | 26.02% | 53.53% | NA |
| Indica I | 595 | 2.70% | 0.30% | 1.68% | 95.29% | NA |
| Indica II | 465 | 3.40% | 1.10% | 8.60% | 86.88% | NA |
| Indica III | 913 | 1.50% | 0.50% | 6.13% | 91.79% | NA |
| Indica Intermediate | 786 | 4.50% | 2.00% | 6.23% | 87.28% | NA |
| Temperate Japonica | 767 | 74.30% | 0.00% | 0.13% | 25.55% | NA |
| Tropical Japonica | 504 | 40.50% | 0.20% | 0.99% | 58.33% | NA |
| Japonica Intermediate | 241 | 25.70% | 0.00% | 0.83% | 73.44% | NA |
| VI/Aromatic | 96 | 14.60% | 8.30% | 20.83% | 56.25% | NA |
| Intermediate | 90 | 35.60% | 1.10% | 7.78% | 55.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1204426116 | A -> DEL | N | N | silent_mutation | Average:15.411; most accessible tissue: Minghui63 root, score: 29.362 | N | N | N | N |
| vg1204426116 | A -> T | LOC_Os12g08700-LOC_Os12g08710 | intergenic_region ; MODIFIER | silent_mutation | Average:15.411; most accessible tissue: Minghui63 root, score: 29.362 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1204426116 | 8.22E-06 | NA | mr1117 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204426116 | NA | 4.41E-07 | mr1190 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204426116 | 2.16E-08 | NA | mr1679 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204426116 | 3.06E-08 | NA | mr1693 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204426116 | NA | 5.44E-07 | mr1693 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1204426116 | NA | 7.79E-13 | mr1496_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |