\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1200951036:

Variant ID: vg1200951036 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 951036
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, C: 0.02, others allele: 0.00, population size: 117. )

Flanking Sequence (100 bp) in Reference Genome:


AAGTGCGCATAAAGTGATAATTAAAGAGCACAACCAGTCAGCAAAAAACACAAGGGAAAAGGATGGTTACGATTATTAGTACTCCCTCCGTTTTGAAATG[T/C]
TTGACCGCCGTTGACTTTTTATCACATGTTTTACCATTTGTCTTATTTAAAAAATTTAATTAATTATTAATTCTTTTCCTATCATTTGATTCGTTGTTAA

Reverse complement sequence

TTAACAACGAATCAAATGATAGGAAAAGAATTAATAATTAATTAAATTTTTTAAATAAGACAAATGGTAAAACATGTGATAAAAAGTCAACGGCGGTCAA[A/G]
CATTTCAAAACGGAGGGAGTACTAATAATCGTAACCATCCTTTTCCCTTGTGTTTTTTGCTGACTGGTTGTGCTCTTTAATTATCACTTTATGCGCACTT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 47.30% 24.70% 1.35% 26.70% NA
All Indica  2759 22.60% 39.80% 2.10% 35.48% NA
All Japonica  1512 96.00% 3.20% 0.07% 0.73% NA
Aus  269 3.00% 0.00% 1.12% 95.91% NA
Indica I  595 51.30% 5.00% 0.00% 43.70% NA
Indica II  465 8.00% 84.70% 0.86% 6.45% NA
Indica III  913 11.80% 41.10% 3.72% 43.37% NA
Indica Intermediate  786 22.10% 38.00% 2.54% 37.28% NA
Temperate Japonica  767 94.50% 4.60% 0.00% 0.91% NA
Tropical Japonica  504 97.20% 2.00% 0.20% 0.60% NA
Japonica Intermediate  241 98.30% 1.20% 0.00% 0.41% NA
VI/Aromatic  96 95.80% 2.10% 0.00% 2.08% NA
Intermediate  90 64.40% 20.00% 2.22% 13.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1200951036 T -> C LOC_Os12g02710.1 upstream_gene_variant ; 837.0bp to feature; MODIFIER silent_mutation Average:69.898; most accessible tissue: Zhenshan97 flower, score: 92.353 N N N N
vg1200951036 T -> C LOC_Os12g02720.1 downstream_gene_variant ; 3416.0bp to feature; MODIFIER silent_mutation Average:69.898; most accessible tissue: Zhenshan97 flower, score: 92.353 N N N N
vg1200951036 T -> C LOC_Os12g02710-LOC_Os12g02720 intergenic_region ; MODIFIER silent_mutation Average:69.898; most accessible tissue: Zhenshan97 flower, score: 92.353 N N N N
vg1200951036 T -> DEL N N silent_mutation Average:69.898; most accessible tissue: Zhenshan97 flower, score: 92.353 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1200951036 NA 5.98E-22 Grain_length All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1200951036 NA 4.28E-26 Grain_length Ind_All YES Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1200951036 NA 1.39E-11 Grain_width Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1200951036 NA 8.58E-20 Plant_height All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1200951036 NA 3.87E-09 mr1174 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200951036 NA 3.31E-13 mr1503 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200951036 NA 3.73E-11 mr1794 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200951036 NA 6.49E-07 mr1860 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200951036 NA 2.35E-08 mr1942 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200951036 NA 3.09E-06 mr1942 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200951036 NA 3.42E-06 mr1944 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200951036 NA 1.32E-10 mr1174_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200951036 NA 4.93E-06 mr1232_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200951036 NA 4.00E-11 mr1319_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200951036 NA 3.17E-06 mr1319_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200951036 NA 1.03E-14 mr1330_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200951036 NA 9.14E-08 mr1330_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200951036 NA 6.09E-08 mr1347_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200951036 NA 1.29E-06 mr1497_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200951036 NA 3.17E-08 mr1557_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200951036 NA 1.74E-10 mr1565_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1200951036 NA 1.45E-09 mr1598_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251