\
| Variant ID: vg1128161380 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 28161380 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.04, others allele: 0.00, population size: 90. )
TAGATTTGTCTTTAAAAGTACTATAATAAAAGTAAACATGCATTTATTTATTGTATATATTATAATAGAAAAATAAGGTCAAAGATATATTTTGTATACC[A/G]
TGTCATTGTCCAAAACGTCAATTAAAATGAAACTGGAGGGAGTAACTAATTAACAAAAAATGGAGTTAACTAAGGTTGGAACAAATCAACAATGCATGTT
AACATGCATTGTTGATTTGTTCCAACCTTAGTTAACTCCATTTTTTGTTAATTAGTTACTCCCTCCAGTTTCATTTTAATTGACGTTTTGGACAATGACA[T/C]
GGTATACAAAATATATCTTTGACCTTATTTTTCTATTATAATATATACAATAAATAAATGCATGTTTACTTTTATTATAGTACTTTTAAAGACAAATCTA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 52.50% | 14.40% | 0.85% | 32.18% | NA |
| All Indica | 2759 | 61.40% | 10.60% | 0.58% | 27.44% | NA |
| All Japonica | 1512 | 38.50% | 15.30% | 0.99% | 45.24% | NA |
| Aus | 269 | 51.30% | 32.30% | 2.23% | 14.13% | NA |
| Indica I | 595 | 55.30% | 6.90% | 1.01% | 36.81% | NA |
| Indica II | 465 | 83.00% | 3.40% | 0.43% | 13.12% | NA |
| Indica III | 913 | 54.20% | 14.30% | 0.44% | 31.00% | NA |
| Indica Intermediate | 786 | 61.50% | 13.40% | 0.51% | 24.68% | NA |
| Temperate Japonica | 767 | 18.30% | 24.30% | 1.56% | 55.93% | NA |
| Tropical Japonica | 504 | 63.70% | 3.60% | 0.40% | 32.34% | NA |
| Japonica Intermediate | 241 | 50.20% | 11.20% | 0.41% | 38.17% | NA |
| VI/Aromatic | 96 | 22.90% | 59.40% | 1.04% | 16.67% | NA |
| Intermediate | 90 | 53.30% | 15.60% | 2.22% | 28.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1128161380 | A -> DEL | N | N | silent_mutation | Average:11.168; most accessible tissue: Callus, score: 23.379 | N | N | N | N |
| vg1128161380 | A -> G | LOC_Os11g46880.1 | intron_variant ; MODIFIER | silent_mutation | Average:11.168; most accessible tissue: Callus, score: 23.379 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1128161380 | 8.98E-06 | NA | mr1149_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1128161380 | 2.83E-08 | NA | mr1310_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1128161380 | 2.29E-06 | NA | mr1423_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1128161380 | 2.85E-06 | NA | mr1691_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1128161380 | 1.14E-06 | NA | mr1945_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1128161380 | 1.30E-09 | NA | mr1959_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1128161380 | 1.06E-06 | 4.25E-07 | mr1959_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |