\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125849043:

Variant ID: vg1125849043 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 25849043
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.02, others allele: 0.00, population size: 200. )

Flanking Sequence (100 bp) in Reference Genome:


AGGCAGCTCAAGCAACAACTATCACTAGCAGACTATTCCTATCGTCCAAAAAGAATTCAAACTAATACTATGGAACATAATCTGTCACAACAAATCTGGA[T/C]
AGGAGCCTGCTCAAGCAACATCTATCACTAGCAGACTACTCCCACCGTCAAAAAAACGCAACATAGTACTTCGATAGAACATAATCTAACACAACGAATC

Reverse complement sequence

GATTCGTTGTGTTAGATTATGTTCTATCGAAGTACTATGTTGCGTTTTTTTGACGGTGGGAGTAGTCTGCTAGTGATAGATGTTGCTTGAGCAGGCTCCT[A/G]
TCCAGATTTGTTGTGACAGATTATGTTCCATAGTATTAGTTTGAATTCTTTTTGGACGATAGGAATAGTCTGCTAGTGATAGTTGTTGCTTGAGCTGCCT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 72.30% 27.60% 0.11% 0.00% NA
All Indica  2759 83.50% 16.30% 0.14% 0.00% NA
All Japonica  1512 53.00% 47.00% 0.00% 0.00% NA
Aus  269 74.30% 25.70% 0.00% 0.00% NA
Indica I  595 56.50% 43.50% 0.00% 0.00% NA
Indica II  465 95.30% 4.30% 0.43% 0.00% NA
Indica III  913 90.40% 9.50% 0.11% 0.00% NA
Indica Intermediate  786 89.10% 10.80% 0.13% 0.00% NA
Temperate Japonica  767 24.30% 75.70% 0.00% 0.00% NA
Tropical Japonica  504 93.80% 6.20% 0.00% 0.00% NA
Japonica Intermediate  241 58.90% 41.10% 0.00% 0.00% NA
VI/Aromatic  96 49.00% 51.00% 0.00% 0.00% NA
Intermediate  90 73.30% 25.60% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1125849043 T -> C LOC_Os11g42900.1 upstream_gene_variant ; 2053.0bp to feature; MODIFIER silent_mutation Average:61.961; most accessible tissue: Minghui63 panicle, score: 96.207 N N N N
vg1125849043 T -> C LOC_Os11g42900-LOC_Os11g42910 intergenic_region ; MODIFIER silent_mutation Average:61.961; most accessible tissue: Minghui63 panicle, score: 96.207 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1125849043 T C 0.05 0.01 0.02 0.04 0.08 0.07

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1125849043 NA 2.91E-17 Grain_length All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1125849043 NA 2.17E-06 mr1060 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125849043 6.16E-07 1.35E-09 mr1191 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125849043 8.15E-08 1.01E-07 mr1191 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125849043 NA 2.25E-06 mr1378 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125849043 1.65E-06 2.06E-10 mr1644 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125849043 3.90E-09 2.43E-08 mr1644 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125849043 8.65E-07 8.61E-07 mr1703 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125849043 NA 5.73E-10 mr1769 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125849043 NA 2.30E-07 mr1937 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125849043 7.35E-08 NA mr1191_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125849043 2.35E-10 1.93E-08 mr1191_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251