\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125798988:

Variant ID: vg1125798988 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 25798988
Reference Allele: AAlternative Allele: C
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.55, C: 0.45, others allele: 0.00, population size: 89. )

Flanking Sequence (100 bp) in Reference Genome:


ACGAGGTTTATTTCCAGCGACTCCATGACCTAGTCGTCTCCTGCAATTTCGGTAAATTTCACCAACAAAAATAATAAAATATATAAACGTACCATGCACC[A/C]
ATCGAATAAACGGAGAACTGTACACACCAAATACCGGATCAGCCTATCAATTTCGTCGGACGACAAAAATTCGAAAAAGCAAATTTGGCTCCCTTTGGTT

Reverse complement sequence

AACCAAAGGGAGCCAAATTTGCTTTTTCGAATTTTTGTCGTCCGACGAAATTGATAGGCTGATCCGGTATTTGGTGTGTACAGTTCTCCGTTTATTCGAT[T/G]
GGTGCATGGTACGTTTATATATTTTATTATTTTTGTTGGTGAAATTTACCGAAATTGCAGGAGACGACTAGGTCATGGAGTCGCTGGAAATAAACCTCGT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 33.70% 33.10% 1.02% 32.10% NA
All Indica  2759 21.20% 28.50% 1.34% 49.00% NA
All Japonica  1512 49.70% 45.60% 0.20% 4.43% NA
Aus  269 70.60% 5.60% 2.23% 21.56% NA
Indica I  595 45.50% 34.50% 0.67% 19.33% NA
Indica II  465 10.30% 24.90% 1.29% 63.44% NA
Indica III  913 8.50% 33.60% 0.33% 57.50% NA
Indica Intermediate  786 23.90% 20.00% 3.05% 53.05% NA
Temperate Japonica  767 78.60% 19.90% 0.39% 1.04% NA
Tropical Japonica  504 9.90% 82.30% 0.00% 7.74% NA
Japonica Intermediate  241 41.10% 50.60% 0.00% 8.30% NA
VI/Aromatic  96 43.80% 38.50% 1.04% 16.67% NA
Intermediate  90 28.90% 43.30% 1.11% 26.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1125798988 A -> DEL N N silent_mutation Average:43.903; most accessible tissue: Zhenshan97 panicle, score: 68.538 N N N N
vg1125798988 A -> C LOC_Os11g42830.1 upstream_gene_variant ; 1931.0bp to feature; MODIFIER silent_mutation Average:43.903; most accessible tissue: Zhenshan97 panicle, score: 68.538 N N N N
vg1125798988 A -> C LOC_Os11g42840.1 upstream_gene_variant ; 652.0bp to feature; MODIFIER silent_mutation Average:43.903; most accessible tissue: Zhenshan97 panicle, score: 68.538 N N N N
vg1125798988 A -> C LOC_Os11g42830-LOC_Os11g42840 intergenic_region ; MODIFIER silent_mutation Average:43.903; most accessible tissue: Zhenshan97 panicle, score: 68.538 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1125798988 NA 1.59E-15 Grain_length All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1125798988 NA 9.19E-06 mr1060 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125798988 2.83E-09 2.77E-11 mr1191 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125798988 6.20E-12 3.92E-14 mr1191 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125798988 NA 4.91E-08 mr1206 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125798988 NA 7.20E-07 mr1229 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125798988 NA 8.98E-06 mr1520 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125798988 NA 3.08E-06 mr1621 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125798988 8.38E-09 6.97E-13 mr1644 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125798988 1.43E-11 1.47E-14 mr1644 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125798988 NA 2.82E-07 mr1880 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125798988 NA 5.44E-06 mr1937 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125798988 1.29E-08 NA mr1191_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125798988 1.74E-13 1.05E-13 mr1191_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125798988 NA 1.24E-06 mr1582_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251