\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125596619:

Variant ID: vg1125596619 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 25596619
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.68, A: 0.32, others allele: 0.00, population size: 195. )

Flanking Sequence (100 bp) in Reference Genome:


CAAGCATCTGCGCTAATTATTCTACATACAATTCTCAGATCGCGTGTGTCAAAAAGATAAAAGAAGATCCTATAAAATTGACATAAAAGGCTCTATACAT[A/G]
TTATTATGAGCCGGCCAGAAAAGAAAAATCTTATTTGTTGGCTTCAGAACTTCTTTTTCAGTAGCTTTACTTGAACTGCTCTTTTTTGGCAGAATGCTTC

Reverse complement sequence

GAAGCATTCTGCCAAAAAAGAGCAGTTCAAGTAAAGCTACTGAAAAAGAAGTTCTGAAGCCAACAAATAAGATTTTTCTTTTCTGGCCGGCTCATAATAA[T/C]
ATGTATAGAGCCTTTTATGTCAATTTTATAGGATCTTCTTTTATCTTTTTGACACACGCGATCTGAGAATTGTATGTAGAATAATTAGCGCAGATGCTTG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.80% 40.90% 0.30% 0.00% NA
All Indica  2759 40.80% 58.70% 0.43% 0.00% NA
All Japonica  1512 92.30% 7.70% 0.00% 0.00% NA
Aus  269 61.30% 38.70% 0.00% 0.00% NA
Indica I  595 59.70% 39.50% 0.84% 0.00% NA
Indica II  465 9.00% 91.00% 0.00% 0.00% NA
Indica III  913 47.20% 52.80% 0.00% 0.00% NA
Indica Intermediate  786 38.00% 61.10% 0.89% 0.00% NA
Temperate Japonica  767 96.10% 3.90% 0.00% 0.00% NA
Tropical Japonica  504 85.70% 14.30% 0.00% 0.00% NA
Japonica Intermediate  241 93.80% 6.20% 0.00% 0.00% NA
VI/Aromatic  96 41.70% 57.30% 1.04% 0.00% NA
Intermediate  90 56.70% 42.20% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1125596619 A -> G LOC_Os11g42510.1 3_prime_UTR_variant ; 44.0bp to feature; MODIFIER silent_mutation Average:59.993; most accessible tissue: Minghui63 flag leaf, score: 87.98 N N N N
vg1125596619 A -> G LOC_Os11g42510.2 3_prime_UTR_variant ; 771.0bp to feature; MODIFIER silent_mutation Average:59.993; most accessible tissue: Minghui63 flag leaf, score: 87.98 N N N N
vg1125596619 A -> G LOC_Os11g42490.1 downstream_gene_variant ; 4893.0bp to feature; MODIFIER silent_mutation Average:59.993; most accessible tissue: Minghui63 flag leaf, score: 87.98 N N N N
vg1125596619 A -> G LOC_Os11g42500.1 downstream_gene_variant ; 1722.0bp to feature; MODIFIER silent_mutation Average:59.993; most accessible tissue: Minghui63 flag leaf, score: 87.98 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1125596619 NA 7.59E-14 Grain_length All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1125596619 9.82E-19 5.50E-24 mr1191 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125596619 2.14E-12 3.76E-10 mr1191 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125596619 NA 5.54E-06 mr1542 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125596619 1.98E-19 2.12E-22 mr1644 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125596619 1.88E-12 7.64E-09 mr1644 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125596619 5.19E-07 5.19E-07 mr1644 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125596619 3.69E-06 NA mr1662 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125596619 1.36E-25 3.48E-31 mr1191_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125596619 5.15E-19 8.76E-13 mr1191_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125596619 6.47E-08 6.47E-08 mr1191_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125596619 NA 3.74E-08 mr1542_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125596619 9.95E-07 9.11E-09 mr1662_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125596619 3.91E-06 NA mr1662_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251