\
| Variant ID: vg1123266458 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 23266458 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.92, A: 0.08, others allele: 0.00, population size: 241. )
GTTAAATGCTGGCCATTCGAGTATGAATTCAATTTTGAAATTTAATATGCATTGTTCGGACTCAATGAATTACGTCTGATATTGGAAGATGACATGTAGT[A/T]
TATTTGAACTGAAAGTTAATGGAGAAACTAAAGAAGAAATAGTGATGATCAAAGTAGATAAAGGGGAAATACTACTCCTTACCTGATAGTGGAGACAAAG
CTTTGTCTCCACTATCAGGTAAGGAGTAGTATTTCCCCTTTATCTACTTTGATCATCACTATTTCTTCTTTAGTTTCTCCATTAACTTTCAGTTCAAATA[T/A]
ACTACATGTCATCTTCCAATATCAGACGTAATTCATTGAGTCCGAACAATGCATATTAAATTTCAAAATTGAATTCATACTCGAATGGCCAGCATTTAAC
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 70.70% | 29.20% | 0.06% | 0.00% | NA |
| All Indica | 2759 | 77.30% | 22.60% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 53.80% | 46.20% | 0.00% | 0.00% | NA |
| Aus | 269 | 90.70% | 9.30% | 0.00% | 0.00% | NA |
| Indica I | 595 | 70.60% | 29.40% | 0.00% | 0.00% | NA |
| Indica II | 465 | 95.50% | 4.50% | 0.00% | 0.00% | NA |
| Indica III | 913 | 76.20% | 23.50% | 0.22% | 0.00% | NA |
| Indica Intermediate | 786 | 73.00% | 27.00% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 24.50% | 75.50% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 85.70% | 14.30% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 80.10% | 19.90% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 87.50% | 12.50% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 75.60% | 23.30% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1123266458 | A -> T | LOC_Os11g39079.1 | downstream_gene_variant ; 3694.0bp to feature; MODIFIER | silent_mutation | Average:60.654; most accessible tissue: Callus, score: 96.472 | N | N | N | N |
| vg1123266458 | A -> T | LOC_Os11g39090.1 | downstream_gene_variant ; 2856.0bp to feature; MODIFIER | silent_mutation | Average:60.654; most accessible tissue: Callus, score: 96.472 | N | N | N | N |
| vg1123266458 | A -> T | LOC_Os11g39090-LOC_Os11g39100 | intergenic_region ; MODIFIER | silent_mutation | Average:60.654; most accessible tissue: Callus, score: 96.472 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1123266458 | NA | 1.13E-16 | Grain_length | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg1123266458 | NA | 6.44E-06 | mr1543 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1123266458 | 3.45E-06 | 4.16E-08 | mr1579 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1123266458 | NA | 2.36E-06 | mr1629 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1123266458 | NA | 2.84E-10 | mr1769 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1123266458 | NA | 1.46E-07 | mr1338_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1123266458 | NA | 1.02E-08 | mr1557_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1123266458 | 7.73E-06 | 7.72E-06 | mr1579_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1123266458 | NA | 4.00E-06 | mr1611_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1123266458 | NA | 2.31E-06 | mr1980_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |