\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1123266458:

Variant ID: vg1123266458 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 23266458
Reference Allele: AAlternative Allele: T
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.92, A: 0.08, others allele: 0.00, population size: 241. )

Flanking Sequence (100 bp) in Reference Genome:


GTTAAATGCTGGCCATTCGAGTATGAATTCAATTTTGAAATTTAATATGCATTGTTCGGACTCAATGAATTACGTCTGATATTGGAAGATGACATGTAGT[A/T]
TATTTGAACTGAAAGTTAATGGAGAAACTAAAGAAGAAATAGTGATGATCAAAGTAGATAAAGGGGAAATACTACTCCTTACCTGATAGTGGAGACAAAG

Reverse complement sequence

CTTTGTCTCCACTATCAGGTAAGGAGTAGTATTTCCCCTTTATCTACTTTGATCATCACTATTTCTTCTTTAGTTTCTCCATTAACTTTCAGTTCAAATA[T/A]
ACTACATGTCATCTTCCAATATCAGACGTAATTCATTGAGTCCGAACAATGCATATTAAATTTCAAAATTGAATTCATACTCGAATGGCCAGCATTTAAC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 70.70% 29.20% 0.06% 0.00% NA
All Indica  2759 77.30% 22.60% 0.07% 0.00% NA
All Japonica  1512 53.80% 46.20% 0.00% 0.00% NA
Aus  269 90.70% 9.30% 0.00% 0.00% NA
Indica I  595 70.60% 29.40% 0.00% 0.00% NA
Indica II  465 95.50% 4.50% 0.00% 0.00% NA
Indica III  913 76.20% 23.50% 0.22% 0.00% NA
Indica Intermediate  786 73.00% 27.00% 0.00% 0.00% NA
Temperate Japonica  767 24.50% 75.50% 0.00% 0.00% NA
Tropical Japonica  504 85.70% 14.30% 0.00% 0.00% NA
Japonica Intermediate  241 80.10% 19.90% 0.00% 0.00% NA
VI/Aromatic  96 87.50% 12.50% 0.00% 0.00% NA
Intermediate  90 75.60% 23.30% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1123266458 A -> T LOC_Os11g39079.1 downstream_gene_variant ; 3694.0bp to feature; MODIFIER silent_mutation Average:60.654; most accessible tissue: Callus, score: 96.472 N N N N
vg1123266458 A -> T LOC_Os11g39090.1 downstream_gene_variant ; 2856.0bp to feature; MODIFIER silent_mutation Average:60.654; most accessible tissue: Callus, score: 96.472 N N N N
vg1123266458 A -> T LOC_Os11g39090-LOC_Os11g39100 intergenic_region ; MODIFIER silent_mutation Average:60.654; most accessible tissue: Callus, score: 96.472 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1123266458 NA 1.13E-16 Grain_length All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1123266458 NA 6.44E-06 mr1543 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123266458 3.45E-06 4.16E-08 mr1579 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123266458 NA 2.36E-06 mr1629 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123266458 NA 2.84E-10 mr1769 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123266458 NA 1.46E-07 mr1338_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123266458 NA 1.02E-08 mr1557_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123266458 7.73E-06 7.72E-06 mr1579_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123266458 NA 4.00E-06 mr1611_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123266458 NA 2.31E-06 mr1980_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251