\
| Variant ID: vg1122246415 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 22246415 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
ATTGGGAATATAAATCATAAATCATAACCTTGGGAGTAACTCTCAAGTTATTGACTTTGAAAATATAAAAATTATATGAATAGATTTGTCTTAAAAAATA[T/C]
TTTCATAAAAGTATACATATATCACTTTTCAATAAATATTTTTATAGAAATAAAAAGTCAAAGTTGTATTTTGGAGACCGTGTCGATATCCTAAACGAAT
ATTCGTTTAGGATATCGACACGGTCTCCAAAATACAACTTTGACTTTTTATTTCTATAAAAATATTTATTGAAAAGTGATATATGTATACTTTTATGAAA[A/G]
TATTTTTTAAGACAAATCTATTCATATAATTTTTATATTTTCAAAGTCAATAACTTGAGAGTTACTCCCAAGGTTATGATTTATGATTTATATTCCCAAT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 86.50% | 13.50% | 0.02% | 0.00% | NA |
| All Indica | 2759 | 96.90% | 3.10% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 65.30% | 34.70% | 0.07% | 0.00% | NA |
| Aus | 269 | 91.80% | 8.20% | 0.00% | 0.00% | NA |
| Indica I | 595 | 95.30% | 4.70% | 0.00% | 0.00% | NA |
| Indica II | 465 | 98.10% | 1.90% | 0.00% | 0.00% | NA |
| Indica III | 913 | 98.60% | 1.40% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 95.50% | 4.50% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 36.00% | 63.90% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 87.10% | 12.90% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 92.20% | 7.80% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1122246415 | T -> C | LOC_Os11g37670.1 | upstream_gene_variant ; 1985.0bp to feature; MODIFIER | silent_mutation | Average:41.236; most accessible tissue: Zhenshan97 panicle, score: 65.386 | N | N | N | N |
| vg1122246415 | T -> C | LOC_Os11g37670-LOC_Os11g37680 | intergenic_region ; MODIFIER | silent_mutation | Average:41.236; most accessible tissue: Zhenshan97 panicle, score: 65.386 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1122246415 | NA | 2.55E-10 | Heading_date | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg1122246415 | NA | 3.93E-11 | Heading_date | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg1122246415 | NA | 3.29E-13 | mr1031 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122246415 | NA | 2.63E-07 | mr1031 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122246415 | NA | 7.82E-13 | mr1056 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122246415 | NA | 6.43E-07 | mr1056 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122246415 | NA | 1.81E-07 | mr1163 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122246415 | NA | 1.14E-09 | mr1252 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122246415 | NA | 1.05E-06 | mr1252 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122246415 | NA | 1.93E-08 | mr1539 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122246415 | 8.14E-06 | NA | mr1611 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122246415 | 3.75E-06 | NA | mr1701 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122246415 | NA | 8.49E-09 | mr1757 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122246415 | 4.91E-06 | 4.91E-06 | mr1796 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122246415 | NA | 9.60E-07 | mr1880 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122246415 | NA | 7.68E-08 | mr1010_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122246415 | NA | 1.48E-06 | mr1011_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122246415 | NA | 1.80E-06 | mr1330_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122246415 | NA | 9.87E-06 | mr1757_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |