\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1122246415:

Variant ID: vg1122246415 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 22246415
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATTGGGAATATAAATCATAAATCATAACCTTGGGAGTAACTCTCAAGTTATTGACTTTGAAAATATAAAAATTATATGAATAGATTTGTCTTAAAAAATA[T/C]
TTTCATAAAAGTATACATATATCACTTTTCAATAAATATTTTTATAGAAATAAAAAGTCAAAGTTGTATTTTGGAGACCGTGTCGATATCCTAAACGAAT

Reverse complement sequence

ATTCGTTTAGGATATCGACACGGTCTCCAAAATACAACTTTGACTTTTTATTTCTATAAAAATATTTATTGAAAAGTGATATATGTATACTTTTATGAAA[A/G]
TATTTTTTAAGACAAATCTATTCATATAATTTTTATATTTTCAAAGTCAATAACTTGAGAGTTACTCCCAAGGTTATGATTTATGATTTATATTCCCAAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 86.50% 13.50% 0.02% 0.00% NA
All Indica  2759 96.90% 3.10% 0.00% 0.00% NA
All Japonica  1512 65.30% 34.70% 0.07% 0.00% NA
Aus  269 91.80% 8.20% 0.00% 0.00% NA
Indica I  595 95.30% 4.70% 0.00% 0.00% NA
Indica II  465 98.10% 1.90% 0.00% 0.00% NA
Indica III  913 98.60% 1.40% 0.00% 0.00% NA
Indica Intermediate  786 95.50% 4.50% 0.00% 0.00% NA
Temperate Japonica  767 36.00% 63.90% 0.13% 0.00% NA
Tropical Japonica  504 99.40% 0.60% 0.00% 0.00% NA
Japonica Intermediate  241 87.10% 12.90% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 92.20% 7.80% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1122246415 T -> C LOC_Os11g37670.1 upstream_gene_variant ; 1985.0bp to feature; MODIFIER silent_mutation Average:41.236; most accessible tissue: Zhenshan97 panicle, score: 65.386 N N N N
vg1122246415 T -> C LOC_Os11g37670-LOC_Os11g37680 intergenic_region ; MODIFIER silent_mutation Average:41.236; most accessible tissue: Zhenshan97 panicle, score: 65.386 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1122246415 NA 2.55E-10 Heading_date All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1122246415 NA 3.93E-11 Heading_date Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1122246415 NA 3.29E-13 mr1031 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122246415 NA 2.63E-07 mr1031 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122246415 NA 7.82E-13 mr1056 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122246415 NA 6.43E-07 mr1056 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122246415 NA 1.81E-07 mr1163 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122246415 NA 1.14E-09 mr1252 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122246415 NA 1.05E-06 mr1252 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122246415 NA 1.93E-08 mr1539 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122246415 8.14E-06 NA mr1611 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122246415 3.75E-06 NA mr1701 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122246415 NA 8.49E-09 mr1757 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122246415 4.91E-06 4.91E-06 mr1796 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122246415 NA 9.60E-07 mr1880 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122246415 NA 7.68E-08 mr1010_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122246415 NA 1.48E-06 mr1011_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122246415 NA 1.80E-06 mr1330_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122246415 NA 9.87E-06 mr1757_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251