\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1122132197:

Variant ID: vg1122132197 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 22132197
Reference Allele: GAlternative Allele: C
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CAATGACCATGTTACCCTTAAAACTATGTAAAGATAAATGCACCATGCCTATGCATGAGGGTAGCAGGTGGAAAAGAGCTACTTTAGTCCCAATAAGCTC[G/C]
TCCCTTAGGGACTTATGGACTAAAGCACTTTAATCCCTTTTTAGTCCCTCCTGTTTAGGACTCTACAGACTTAAAGTGAAGAGACTTATTTTTTAGACCC

Reverse complement sequence

GGGTCTAAAAAATAAGTCTCTTCACTTTAAGTCTGTAGAGTCCTAAACAGGAGGGACTAAAAAGGGATTAAAGTGCTTTAGTCCATAAGTCCCTAAGGGA[C/G]
GAGCTTATTGGGACTAAAGTAGCTCTTTTCCACCTGCTACCCTCATGCATAGGCATGGTGCATTTATCTTTACATAGTTTTAAGGGTAACATGGTCATTG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 61.30% 12.20% 0.49% 26.07% NA
All Indica  2759 79.20% 0.50% 0.47% 19.83% NA
All Japonica  1512 35.40% 36.10% 0.60% 27.91% NA
Aus  269 20.10% 0.00% 0.37% 79.55% NA
Indica I  595 62.40% 1.20% 1.51% 34.96% NA
Indica II  465 98.30% 0.00% 0.00% 1.72% NA
Indica III  913 76.70% 0.40% 0.11% 22.78% NA
Indica Intermediate  786 83.50% 0.50% 0.38% 15.65% NA
Temperate Japonica  767 25.80% 63.40% 0.52% 10.30% NA
Tropical Japonica  504 48.80% 6.20% 0.40% 44.64% NA
Japonica Intermediate  241 37.80% 12.00% 1.24% 48.96% NA
VI/Aromatic  96 69.80% 6.20% 0.00% 23.96% NA
Intermediate  90 61.10% 10.00% 0.00% 28.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1122132197 G -> DEL N N silent_mutation Average:81.463; most accessible tissue: Zhenshan97 flower, score: 95.361 N N N N
vg1122132197 G -> C LOC_Os11g37500.1 upstream_gene_variant ; 3917.0bp to feature; MODIFIER silent_mutation Average:81.463; most accessible tissue: Zhenshan97 flower, score: 95.361 N N N N
vg1122132197 G -> C LOC_Os11g37480.1 downstream_gene_variant ; 1073.0bp to feature; MODIFIER silent_mutation Average:81.463; most accessible tissue: Zhenshan97 flower, score: 95.361 N N N N
vg1122132197 G -> C LOC_Os11g37490.1 downstream_gene_variant ; 2236.0bp to feature; MODIFIER silent_mutation Average:81.463; most accessible tissue: Zhenshan97 flower, score: 95.361 N N N N
vg1122132197 G -> C LOC_Os11g37480-LOC_Os11g37490 intergenic_region ; MODIFIER silent_mutation Average:81.463; most accessible tissue: Zhenshan97 flower, score: 95.361 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1122132197 G C -0.02 -0.02 0.0 -0.03 -0.02 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1122132197 NA 1.79E-15 Heading_date All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1122132197 NA 2.75E-14 Heading_date Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1122132197 NA 6.46E-15 Spikelet_length All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1122132197 NA 1.59E-12 mr1031 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122132197 NA 5.69E-07 mr1031 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122132197 NA 3.17E-06 mr1056 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122132197 NA 2.75E-07 mr1252 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122132197 NA 8.90E-08 mr1010_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122132197 NA 9.42E-06 mr1263_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122132197 NA 1.57E-06 mr1330_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122132197 NA 9.48E-10 mr1576_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122132197 3.06E-06 NA mr1579_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122132197 3.20E-06 3.20E-06 mr1579_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122132197 NA 1.33E-06 mr1621_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122132197 NA 8.75E-13 mr1879_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251