Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1122132197:

Variant ID: vg1122132197 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 22132197
Reference Allele: G	Alternative Allele: C
Primary Allele: C	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CAATGACCATGTTACCCTTAAAACTATGTAAAGATAAATGCACCATGCCTATGCATGAGGGTAGCAGGTGGAAAAGAGCTACTTTAGTCCCAATAAGCTC[G/C]
TCCCTTAGGGACTTATGGACTAAAGCACTTTAATCCCTTTTTAGTCCCTCCTGTTTAGGACTCTACAGACTTAAAGTGAAGAGACTTATTTTTTAGACCC

Reverse complement sequence

GGGTCTAAAAAATAAGTCTCTTCACTTTAAGTCTGTAGAGTCCTAAACAGGAGGGACTAAAAAGGGATTAAAGTGCTTTAGTCCATAAGTCCCTAAGGGA[C/G]
GAGCTTATTGGGACTAAAGTAGCTCTTTTCCACCTGCTACCCTCATGCATAGGCATGGTGCATTTATCTTTACATAGTTTTAAGGGTAACATGGTCATTG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	61.30%	12.20%	0.49%	26.07%	NA
All Indica	2759	79.20%	0.50%	0.47%	19.83%	NA
All Japonica	1512	35.40%	36.10%	0.60%	27.91%	NA
Aus	269	20.10%	0.00%	0.37%	79.55%	NA
Indica I	595	62.40%	1.20%	1.51%	34.96%	NA
Indica II	465	98.30%	0.00%	0.00%	1.72%	NA
Indica III	913	76.70%	0.40%	0.11%	22.78%	NA
Indica Intermediate	786	83.50%	0.50%	0.38%	15.65%	NA
Temperate Japonica	767	25.80%	63.40%	0.52%	10.30%	NA
Tropical Japonica	504	48.80%	6.20%	0.40%	44.64%	NA
Japonica Intermediate	241	37.80%	12.00%	1.24%	48.96%	NA
VI/Aromatic	96	69.80%	6.20%	0.00%	23.96%	NA
Intermediate	90	61.10%	10.00%	0.00%	28.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1122132197	G -> DEL	N	N	silent_mutation	Average:81.463; most accessible tissue: Zhenshan97 flower, score: 95.361	N	N	N	N
vg1122132197	G -> C	LOC_Os11g37500.1	upstream_gene_variant ; 3917.0bp to feature; MODIFIER	silent_mutation	Average:81.463; most accessible tissue: Zhenshan97 flower, score: 95.361	N	N	N	N
vg1122132197	G -> C	LOC_Os11g37480.1	downstream_gene_variant ; 1073.0bp to feature; MODIFIER	silent_mutation	Average:81.463; most accessible tissue: Zhenshan97 flower, score: 95.361	N	N	N	N
vg1122132197	G -> C	LOC_Os11g37490.1	downstream_gene_variant ; 2236.0bp to feature; MODIFIER	silent_mutation	Average:81.463; most accessible tissue: Zhenshan97 flower, score: 95.361	N	N	N	N
vg1122132197	G -> C	LOC_Os11g37480-LOC_Os11g37490	intergenic_region ; MODIFIER	silent_mutation	Average:81.463; most accessible tissue: Zhenshan97 flower, score: 95.361	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg1122132197	G	C	-0.02	-0.02	0.0	-0.03	-0.02	0.0

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1122132197	NA	1.79E-15	Heading_date	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1122132197	NA	2.75E-14	Heading_date	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1122132197	NA	6.46E-15	Spikelet_length	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1122132197	NA	1.59E-12	mr1031	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122132197	NA	5.69E-07	mr1031	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122132197	NA	3.17E-06	mr1056	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122132197	NA	2.75E-07	mr1252	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122132197	NA	8.90E-08	mr1010_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122132197	NA	9.42E-06	mr1263_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122132197	NA	1.57E-06	mr1330_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122132197	NA	9.48E-10	mr1576_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122132197	3.06E-06	NA	mr1579_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122132197	3.20E-06	3.20E-06	mr1579_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122132197	NA	1.33E-06	mr1621_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122132197	NA	8.75E-13	mr1879_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251