\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1122092252:

Variant ID: vg1122092252 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 22092252
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.89, T: 0.11, others allele: 0.00, population size: 54. )

Flanking Sequence (100 bp) in Reference Genome:


GGTGTTCACCAAAATACCATTTTCGTTTCTTTTTTGTGAATAGAAATGTTTTTGCTCAATTTTATTTTTTCCCCGGATCAAAAATACCCCTAATGTGAAC[T/C]
CCACCTGTCATACTCTCTCCCCTCTTCCTCCCTCTCGAGGATGGCCTCGGCTGGCGGGCATGGCGGGTAGTGGCCGGTGGCCGGCAACGGGCGTGGCGGG

Reverse complement sequence

CCCGCCACGCCCGTTGCCGGCCACCGGCCACTACCCGCCATGCCCGCCAGCCGAGGCCATCCTCGAGAGGGAGGAAGAGGGGAGAGAGTATGACAGGTGG[A/G]
GTTCACATTAGGGGTATTTTTGATCCGGGGAAAAAATAAAATTGAGCAAAAACATTTCTATTCACAAAAAAGAAACGAAAATGGTATTTTGGTGAACACC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 30.90% 17.20% 0.34% 51.59% NA
All Indica  2759 29.90% 2.20% 0.43% 67.38% NA
All Japonica  1512 23.10% 48.10% 0.13% 28.64% NA
Aus  269 68.00% 1.10% 0.00% 30.86% NA
Indica I  595 31.60% 1.50% 0.17% 66.72% NA
Indica II  465 34.80% 1.10% 0.43% 63.66% NA
Indica III  913 23.20% 4.30% 0.66% 71.85% NA
Indica Intermediate  786 33.60% 1.10% 0.38% 64.89% NA
Temperate Japonica  767 19.30% 71.10% 0.00% 9.65% NA
Tropical Japonica  504 34.10% 18.70% 0.40% 46.83% NA
Japonica Intermediate  241 12.40% 36.50% 0.00% 51.04% NA
VI/Aromatic  96 68.80% 6.20% 0.00% 25.00% NA
Intermediate  90 37.80% 16.70% 2.22% 43.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1122092252 T -> DEL N N silent_mutation Average:36.079; most accessible tissue: Zhenshan97 flag leaf, score: 80.588 N N N N
vg1122092252 T -> C LOC_Os11g37400.1 downstream_gene_variant ; 3934.0bp to feature; MODIFIER silent_mutation Average:36.079; most accessible tissue: Zhenshan97 flag leaf, score: 80.588 N N N N
vg1122092252 T -> C LOC_Os11g37410.1 downstream_gene_variant ; 1565.0bp to feature; MODIFIER silent_mutation Average:36.079; most accessible tissue: Zhenshan97 flag leaf, score: 80.588 N N N N
vg1122092252 T -> C LOC_Os11g37420.1 downstream_gene_variant ; 2337.0bp to feature; MODIFIER silent_mutation Average:36.079; most accessible tissue: Zhenshan97 flag leaf, score: 80.588 N N N N
vg1122092252 T -> C LOC_Os11g37410-LOC_Os11g37420 intergenic_region ; MODIFIER silent_mutation Average:36.079; most accessible tissue: Zhenshan97 flag leaf, score: 80.588 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1122092252 NA 7.32E-10 Heading_date All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1122092252 NA 4.60E-08 mr1156_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122092252 4.17E-06 2.90E-06 mr1332_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122092252 NA 4.57E-06 mr1371_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122092252 NA 1.96E-08 mr1576_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122092252 NA 5.19E-06 mr1621_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122092252 NA 5.47E-06 mr1648_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122092252 NA 7.78E-06 mr1663_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122092252 8.49E-06 8.49E-06 mr1760_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122092252 NA 4.73E-11 mr1879_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122092252 NA 1.32E-07 mr1977_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122092252 NA 6.52E-06 mr1977_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122092252 NA 3.70E-18 mr1980_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122092252 NA 3.33E-06 mr1980_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251