\
| Variant ID: vg1122092252 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 22092252 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.89, T: 0.11, others allele: 0.00, population size: 54. )
GGTGTTCACCAAAATACCATTTTCGTTTCTTTTTTGTGAATAGAAATGTTTTTGCTCAATTTTATTTTTTCCCCGGATCAAAAATACCCCTAATGTGAAC[T/C]
CCACCTGTCATACTCTCTCCCCTCTTCCTCCCTCTCGAGGATGGCCTCGGCTGGCGGGCATGGCGGGTAGTGGCCGGTGGCCGGCAACGGGCGTGGCGGG
CCCGCCACGCCCGTTGCCGGCCACCGGCCACTACCCGCCATGCCCGCCAGCCGAGGCCATCCTCGAGAGGGAGGAAGAGGGGAGAGAGTATGACAGGTGG[A/G]
GTTCACATTAGGGGTATTTTTGATCCGGGGAAAAAATAAAATTGAGCAAAAACATTTCTATTCACAAAAAAGAAACGAAAATGGTATTTTGGTGAACACC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 30.90% | 17.20% | 0.34% | 51.59% | NA |
| All Indica | 2759 | 29.90% | 2.20% | 0.43% | 67.38% | NA |
| All Japonica | 1512 | 23.10% | 48.10% | 0.13% | 28.64% | NA |
| Aus | 269 | 68.00% | 1.10% | 0.00% | 30.86% | NA |
| Indica I | 595 | 31.60% | 1.50% | 0.17% | 66.72% | NA |
| Indica II | 465 | 34.80% | 1.10% | 0.43% | 63.66% | NA |
| Indica III | 913 | 23.20% | 4.30% | 0.66% | 71.85% | NA |
| Indica Intermediate | 786 | 33.60% | 1.10% | 0.38% | 64.89% | NA |
| Temperate Japonica | 767 | 19.30% | 71.10% | 0.00% | 9.65% | NA |
| Tropical Japonica | 504 | 34.10% | 18.70% | 0.40% | 46.83% | NA |
| Japonica Intermediate | 241 | 12.40% | 36.50% | 0.00% | 51.04% | NA |
| VI/Aromatic | 96 | 68.80% | 6.20% | 0.00% | 25.00% | NA |
| Intermediate | 90 | 37.80% | 16.70% | 2.22% | 43.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1122092252 | T -> DEL | N | N | silent_mutation | Average:36.079; most accessible tissue: Zhenshan97 flag leaf, score: 80.588 | N | N | N | N |
| vg1122092252 | T -> C | LOC_Os11g37400.1 | downstream_gene_variant ; 3934.0bp to feature; MODIFIER | silent_mutation | Average:36.079; most accessible tissue: Zhenshan97 flag leaf, score: 80.588 | N | N | N | N |
| vg1122092252 | T -> C | LOC_Os11g37410.1 | downstream_gene_variant ; 1565.0bp to feature; MODIFIER | silent_mutation | Average:36.079; most accessible tissue: Zhenshan97 flag leaf, score: 80.588 | N | N | N | N |
| vg1122092252 | T -> C | LOC_Os11g37420.1 | downstream_gene_variant ; 2337.0bp to feature; MODIFIER | silent_mutation | Average:36.079; most accessible tissue: Zhenshan97 flag leaf, score: 80.588 | N | N | N | N |
| vg1122092252 | T -> C | LOC_Os11g37410-LOC_Os11g37420 | intergenic_region ; MODIFIER | silent_mutation | Average:36.079; most accessible tissue: Zhenshan97 flag leaf, score: 80.588 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1122092252 | NA | 7.32E-10 | Heading_date | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg1122092252 | NA | 4.60E-08 | mr1156_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122092252 | 4.17E-06 | 2.90E-06 | mr1332_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122092252 | NA | 4.57E-06 | mr1371_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122092252 | NA | 1.96E-08 | mr1576_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122092252 | NA | 5.19E-06 | mr1621_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122092252 | NA | 5.47E-06 | mr1648_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122092252 | NA | 7.78E-06 | mr1663_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122092252 | 8.49E-06 | 8.49E-06 | mr1760_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122092252 | NA | 4.73E-11 | mr1879_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122092252 | NA | 1.32E-07 | mr1977_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122092252 | NA | 6.52E-06 | mr1977_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122092252 | NA | 3.70E-18 | mr1980_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122092252 | NA | 3.33E-06 | mr1980_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |