\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1122062760:

Variant ID: vg1122062760 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 22062760
Reference Allele: TAlternative Allele: A
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CGGCAGGGCTAGCTCCCGTGGCGTCGCTCTCCTCCTCCTTGCTAGCGGCCGCGACTAGTGTGGACAGGGGCACGACAGGGAGCATGGCGGTGGAAAGGCT[T/A]
GCTCCTGCGGTGCTGCTATCCTCCTCCTCGCCAGCGGTCATGTGCAGCGTGGACAGGGACACGGCGAAGGCACCACGCTGCGCGGCCAGGAGCTCCCGCT

Reverse complement sequence

AGCGGGAGCTCCTGGCCGCGCAGCGTGGTGCCTTCGCCGTGTCCCTGTCCACGCTGCACATGACCGCTGGCGAGGAGGAGGATAGCAGCACCGCAGGAGC[A/T]
AGCCTTTCCACCGCCATGCTCCCTGTCGTGCCCCTGTCCACACTAGTCGCGGCCGCTAGCAAGGAGGAGGAGAGCGACGCCACGGGAGCTAGCCCTGCCG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 82.40% 12.50% 0.06% 5.10% NA
All Indica  2759 95.40% 0.60% 0.07% 3.95% NA
All Japonica  1512 60.40% 37.00% 0.00% 2.51% NA
Aus  269 74.00% 0.00% 0.37% 25.65% NA
Indica I  595 98.80% 0.80% 0.17% 0.17% NA
Indica II  465 98.90% 0.60% 0.00% 0.43% NA
Indica III  913 92.00% 0.40% 0.00% 7.56% NA
Indica Intermediate  786 94.50% 0.60% 0.13% 4.71% NA
Temperate Japonica  767 34.90% 64.50% 0.00% 0.52% NA
Tropical Japonica  504 88.30% 6.30% 0.00% 5.36% NA
Japonica Intermediate  241 83.40% 13.70% 0.00% 2.90% NA
VI/Aromatic  96 77.10% 3.10% 0.00% 19.79% NA
Intermediate  90 83.30% 10.00% 0.00% 6.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1122062760 T -> A LOC_Os11g37380.1 downstream_gene_variant ; 807.0bp to feature; MODIFIER silent_mutation Average:74.811; most accessible tissue: Zhenshan97 young leaf, score: 88.637 N N N N
vg1122062760 T -> A LOC_Os11g37380-LOC_Os11g37390 intergenic_region ; MODIFIER silent_mutation Average:74.811; most accessible tissue: Zhenshan97 young leaf, score: 88.637 N N N N
vg1122062760 T -> DEL N N silent_mutation Average:74.811; most accessible tissue: Zhenshan97 young leaf, score: 88.637 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1122062760 NA 1.50E-11 Heading_date All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1122062760 NA 1.16E-12 mr1031 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122062760 NA 3.36E-07 mr1031 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122062760 NA 1.12E-07 mr1045 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122062760 NA 4.98E-13 mr1056 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122062760 NA 9.18E-07 mr1056 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122062760 NA 3.46E-22 mr1115 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122062760 NA 6.84E-09 mr1137 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122062760 NA 3.64E-06 mr1521 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122062760 NA 8.22E-06 mr1543 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122062760 NA 8.71E-07 mr1543 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122062760 NA 3.50E-07 mr1579 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122062760 NA 6.03E-08 mr1617 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122062760 NA 2.65E-07 mr1629 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122062760 NA 3.19E-06 mr1729 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122062760 NA 4.27E-12 mr1741 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122062760 NA 1.27E-11 mr1879 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122062760 NA 8.63E-06 mr1380_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122062760 NA 8.77E-06 mr1561_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122062760 4.55E-06 NA mr1579_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122062760 5.58E-07 5.57E-07 mr1579_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122062760 NA 3.88E-07 mr1621_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122062760 1.43E-06 1.70E-07 mr1996_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251