\
| Variant ID: vg1122062760 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 22062760 |
| Reference Allele: T | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
CGGCAGGGCTAGCTCCCGTGGCGTCGCTCTCCTCCTCCTTGCTAGCGGCCGCGACTAGTGTGGACAGGGGCACGACAGGGAGCATGGCGGTGGAAAGGCT[T/A]
GCTCCTGCGGTGCTGCTATCCTCCTCCTCGCCAGCGGTCATGTGCAGCGTGGACAGGGACACGGCGAAGGCACCACGCTGCGCGGCCAGGAGCTCCCGCT
AGCGGGAGCTCCTGGCCGCGCAGCGTGGTGCCTTCGCCGTGTCCCTGTCCACGCTGCACATGACCGCTGGCGAGGAGGAGGATAGCAGCACCGCAGGAGC[A/T]
AGCCTTTCCACCGCCATGCTCCCTGTCGTGCCCCTGTCCACACTAGTCGCGGCCGCTAGCAAGGAGGAGGAGAGCGACGCCACGGGAGCTAGCCCTGCCG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 82.40% | 12.50% | 0.06% | 5.10% | NA |
| All Indica | 2759 | 95.40% | 0.60% | 0.07% | 3.95% | NA |
| All Japonica | 1512 | 60.40% | 37.00% | 0.00% | 2.51% | NA |
| Aus | 269 | 74.00% | 0.00% | 0.37% | 25.65% | NA |
| Indica I | 595 | 98.80% | 0.80% | 0.17% | 0.17% | NA |
| Indica II | 465 | 98.90% | 0.60% | 0.00% | 0.43% | NA |
| Indica III | 913 | 92.00% | 0.40% | 0.00% | 7.56% | NA |
| Indica Intermediate | 786 | 94.50% | 0.60% | 0.13% | 4.71% | NA |
| Temperate Japonica | 767 | 34.90% | 64.50% | 0.00% | 0.52% | NA |
| Tropical Japonica | 504 | 88.30% | 6.30% | 0.00% | 5.36% | NA |
| Japonica Intermediate | 241 | 83.40% | 13.70% | 0.00% | 2.90% | NA |
| VI/Aromatic | 96 | 77.10% | 3.10% | 0.00% | 19.79% | NA |
| Intermediate | 90 | 83.30% | 10.00% | 0.00% | 6.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1122062760 | T -> A | LOC_Os11g37380.1 | downstream_gene_variant ; 807.0bp to feature; MODIFIER | silent_mutation | Average:74.811; most accessible tissue: Zhenshan97 young leaf, score: 88.637 | N | N | N | N |
| vg1122062760 | T -> A | LOC_Os11g37380-LOC_Os11g37390 | intergenic_region ; MODIFIER | silent_mutation | Average:74.811; most accessible tissue: Zhenshan97 young leaf, score: 88.637 | N | N | N | N |
| vg1122062760 | T -> DEL | N | N | silent_mutation | Average:74.811; most accessible tissue: Zhenshan97 young leaf, score: 88.637 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1122062760 | NA | 1.50E-11 | Heading_date | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg1122062760 | NA | 1.16E-12 | mr1031 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122062760 | NA | 3.36E-07 | mr1031 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122062760 | NA | 1.12E-07 | mr1045 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122062760 | NA | 4.98E-13 | mr1056 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122062760 | NA | 9.18E-07 | mr1056 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122062760 | NA | 3.46E-22 | mr1115 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122062760 | NA | 6.84E-09 | mr1137 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122062760 | NA | 3.64E-06 | mr1521 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122062760 | NA | 8.22E-06 | mr1543 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122062760 | NA | 8.71E-07 | mr1543 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122062760 | NA | 3.50E-07 | mr1579 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122062760 | NA | 6.03E-08 | mr1617 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122062760 | NA | 2.65E-07 | mr1629 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122062760 | NA | 3.19E-06 | mr1729 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122062760 | NA | 4.27E-12 | mr1741 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122062760 | NA | 1.27E-11 | mr1879 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122062760 | NA | 8.63E-06 | mr1380_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122062760 | NA | 8.77E-06 | mr1561_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122062760 | 4.55E-06 | NA | mr1579_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122062760 | 5.58E-07 | 5.57E-07 | mr1579_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122062760 | NA | 3.88E-07 | mr1621_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122062760 | 1.43E-06 | 1.70E-07 | mr1996_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |