\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1122032445:

Variant ID: vg1122032445 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 22032445
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.53, A: 0.47, others allele: 0.00, population size: 97. )

Flanking Sequence (100 bp) in Reference Genome:


TTTTGGTAGAGCAAAGTTAGCTAGCTATGTTTGGTTTGGTACCAATGTAAAGCCAAATTTTAGTAGGATGGTGAAGAAGATTCTAGAATATAGCCAAATT[G/A]
AATATGTACACTACCAATTATTTGACATCAATCCAAACTAGCACATTTCCTATTTAAGTTACCAAAATTTTGGTATGGCATGTTTTGCCTTTAATCCAAA

Reverse complement sequence

TTTGGATTAAAGGCAAAACATGCCATACCAAAATTTTGGTAACTTAAATAGGAAATGTGCTAGTTTGGATTGATGTCAAATAATTGGTAGTGTACATATT[C/T]
AATTTGGCTATATTCTAGAATCTTCTTCACCATCCTACTAAAATTTGGCTTTACATTGGTACCAAACCAAACATAGCTAGCTAACTTTGCTCTACCAAAA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 61.60% 33.00% 0.32% 5.12% NA
All Indica  2759 78.90% 16.90% 0.29% 3.99% NA
All Japonica  1512 27.10% 70.20% 0.13% 2.58% NA
Aus  269 69.50% 3.70% 1.12% 25.65% NA
Indica I  595 79.20% 20.30% 0.17% 0.34% NA
Indica II  465 68.00% 31.00% 0.43% 0.65% NA
Indica III  913 85.90% 6.60% 0.22% 7.34% NA
Indica Intermediate  786 77.00% 17.80% 0.38% 4.83% NA
Temperate Japonica  767 18.10% 81.00% 0.26% 0.65% NA
Tropical Japonica  504 37.50% 57.10% 0.00% 5.36% NA
Japonica Intermediate  241 34.00% 63.10% 0.00% 2.90% NA
VI/Aromatic  96 78.10% 2.10% 1.04% 18.75% NA
Intermediate  90 70.00% 22.20% 1.11% 6.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1122032445 G -> A LOC_Os11g37310.1 upstream_gene_variant ; 374.0bp to feature; MODIFIER silent_mutation Average:49.873; most accessible tissue: Minghui63 panicle, score: 73.225 N N N N
vg1122032445 G -> A LOC_Os11g37300.1 downstream_gene_variant ; 2697.0bp to feature; MODIFIER silent_mutation Average:49.873; most accessible tissue: Minghui63 panicle, score: 73.225 N N N N
vg1122032445 G -> A LOC_Os11g37300-LOC_Os11g37310 intergenic_region ; MODIFIER silent_mutation Average:49.873; most accessible tissue: Minghui63 panicle, score: 73.225 N N N N
vg1122032445 G -> DEL N N silent_mutation Average:49.873; most accessible tissue: Minghui63 panicle, score: 73.225 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1122032445 NA 1.32E-11 Heading_date All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1122032445 NA 6.31E-08 mr1045_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122032445 NA 7.66E-06 mr1053_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122032445 NA 8.62E-08 mr1060_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122032445 NA 3.72E-06 mr1204_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122032445 NA 1.29E-06 mr1220_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122032445 NA 2.30E-08 mr1252_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122032445 NA 2.15E-06 mr1358_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122032445 NA 2.54E-06 mr1359_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122032445 NA 5.76E-06 mr1545_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122032445 NA 1.79E-06 mr1555_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122032445 NA 1.19E-10 mr1624_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122032445 NA 4.16E-06 mr1624_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122032445 NA 9.70E-06 mr1641_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122032445 NA 3.25E-07 mr1653_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122032445 NA 1.96E-06 mr1729_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122032445 NA 5.91E-09 mr1741_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122032445 NA 3.58E-06 mr1759_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122032445 NA 3.70E-06 mr1785_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122032445 NA 1.29E-08 mr1788_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122032445 NA 2.98E-07 mr1807_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122032445 NA 2.64E-06 mr1971_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122032445 NA 6.42E-06 mr1996_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251