Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1122032445:

Variant ID: vg1122032445 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 22032445
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.53, A: 0.47, others allele: 0.00, population size: 97. )

Flanking Sequence (100 bp) in Reference Genome:

TTTTGGTAGAGCAAAGTTAGCTAGCTATGTTTGGTTTGGTACCAATGTAAAGCCAAATTTTAGTAGGATGGTGAAGAAGATTCTAGAATATAGCCAAATT[G/A]
AATATGTACACTACCAATTATTTGACATCAATCCAAACTAGCACATTTCCTATTTAAGTTACCAAAATTTTGGTATGGCATGTTTTGCCTTTAATCCAAA

Reverse complement sequence

TTTGGATTAAAGGCAAAACATGCCATACCAAAATTTTGGTAACTTAAATAGGAAATGTGCTAGTTTGGATTGATGTCAAATAATTGGTAGTGTACATATT[C/T]
AATTTGGCTATATTCTAGAATCTTCTTCACCATCCTACTAAAATTTGGCTTTACATTGGTACCAAACCAAACATAGCTAGCTAACTTTGCTCTACCAAAA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	61.60%	33.00%	0.32%	5.12%	NA
All Indica	2759	78.90%	16.90%	0.29%	3.99%	NA
All Japonica	1512	27.10%	70.20%	0.13%	2.58%	NA
Aus	269	69.50%	3.70%	1.12%	25.65%	NA
Indica I	595	79.20%	20.30%	0.17%	0.34%	NA
Indica II	465	68.00%	31.00%	0.43%	0.65%	NA
Indica III	913	85.90%	6.60%	0.22%	7.34%	NA
Indica Intermediate	786	77.00%	17.80%	0.38%	4.83%	NA
Temperate Japonica	767	18.10%	81.00%	0.26%	0.65%	NA
Tropical Japonica	504	37.50%	57.10%	0.00%	5.36%	NA
Japonica Intermediate	241	34.00%	63.10%	0.00%	2.90%	NA
VI/Aromatic	96	78.10%	2.10%	1.04%	18.75%	NA
Intermediate	90	70.00%	22.20%	1.11%	6.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1122032445	G -> A	LOC_Os11g37310.1	upstream_gene_variant ; 374.0bp to feature; MODIFIER	silent_mutation	Average:49.873; most accessible tissue: Minghui63 panicle, score: 73.225	N	N	N	N
vg1122032445	G -> A	LOC_Os11g37300.1	downstream_gene_variant ; 2697.0bp to feature; MODIFIER	silent_mutation	Average:49.873; most accessible tissue: Minghui63 panicle, score: 73.225	N	N	N	N
vg1122032445	G -> A	LOC_Os11g37300-LOC_Os11g37310	intergenic_region ; MODIFIER	silent_mutation	Average:49.873; most accessible tissue: Minghui63 panicle, score: 73.225	N	N	N	N
vg1122032445	G -> DEL	N	N	silent_mutation	Average:49.873; most accessible tissue: Minghui63 panicle, score: 73.225	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1122032445	NA	1.32E-11	Heading_date	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1122032445	NA	6.31E-08	mr1045_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122032445	NA	7.66E-06	mr1053_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122032445	NA	8.62E-08	mr1060_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122032445	NA	3.72E-06	mr1204_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122032445	NA	1.29E-06	mr1220_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122032445	NA	2.30E-08	mr1252_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122032445	NA	2.15E-06	mr1358_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122032445	NA	2.54E-06	mr1359_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122032445	NA	5.76E-06	mr1545_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122032445	NA	1.79E-06	mr1555_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122032445	NA	1.19E-10	mr1624_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122032445	NA	4.16E-06	mr1624_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122032445	NA	9.70E-06	mr1641_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122032445	NA	3.25E-07	mr1653_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122032445	NA	1.96E-06	mr1729_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122032445	NA	5.91E-09	mr1741_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122032445	NA	3.58E-06	mr1759_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122032445	NA	3.70E-06	mr1785_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122032445	NA	1.29E-08	mr1788_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122032445	NA	2.98E-07	mr1807_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122032445	NA	2.64E-06	mr1971_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122032445	NA	6.42E-06	mr1996_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251