Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1121957619:

Variant ID: vg1121957619 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 21957619
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.03, others allele: 0.00, population size: 59. )

Flanking Sequence (100 bp) in Reference Genome:


CAGGTGGTGTTTGGATCCAGGGACTTAACTTTAGTCTCTGTATTTAGACACTAATTTAGAGTATTAAATATAGACTACTTATAAAACTAATTAGATAAAT[G/A]
AAAGCTAATTTGTGAGACAAATTTTTTAAGCCTAATTAATCTATAATTAGATAATGTTTACTGTAGCATCACTTAGGCTAATTATGGATTAATTAGGCTC

Reverse complement sequence

GAGCCTAATTAATCCATAATTAGCCTAAGTGATGCTACAGTAAACATTATCTAATTATAGATTAATTAGGCTTAAAAAATTTGTCTCACAAATTAGCTTT[C/T]
ATTTATCTAATTAGTTTTATAAGTAGTCTATATTTAATACTCTAAATTAGTGTCTAAATACAGAGACTAAAGTTAAGTCCCTGGATCCAAACACCACCTG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 50.60% 44.30% 0.15% 5.01% NA
All Indica  2759 66.00% 29.90% 0.18% 3.91% NA
All Japonica  1512 28.80% 68.50% 0.07% 2.58% NA
Aus  269 3.00% 72.50% 0.00% 24.54% NA
Indica I  595 31.10% 68.60% 0.17% 0.17% NA
Indica II  465 65.60% 33.80% 0.22% 0.43% NA
Indica III  913 84.70% 7.70% 0.33% 7.34% NA
Indica Intermediate  786 71.00% 24.20% 0.00% 4.83% NA
Temperate Japonica  767 13.70% 85.50% 0.13% 0.65% NA
Tropical Japonica  504 56.20% 38.50% 0.00% 5.36% NA
Japonica Intermediate  241 19.90% 77.20% 0.00% 2.90% NA
VI/Aromatic  96 78.10% 3.10% 0.00% 18.75% NA
Intermediate  90 55.60% 36.70% 1.11% 6.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1121957619 G -> A LOC_Os11g37180.1 upstream_gene_variant ; 2958.0bp to feature; MODIFIER silent_mutation Average:64.716; most accessible tissue: Zhenshan97 panicle, score: 93.936 N N N N
vg1121957619 G -> A LOC_Os11g37180-LOC_Os11g37190 intergenic_region ; MODIFIER silent_mutation Average:64.716; most accessible tissue: Zhenshan97 panicle, score: 93.936 N N N N
vg1121957619 G -> DEL N N silent_mutation Average:64.716; most accessible tissue: Zhenshan97 panicle, score: 93.936 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1121957619 G A 0.03 0.05 0.03 -0.01 0.03 0.04

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1121957619 NA 2.15E-14 Heading_date All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1121957619 NA 1.58E-10 Heading_date Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1121957619 NA 5.79E-08 mr1045 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121957619 NA 7.05E-06 mr1520 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121957619 NA 6.01E-07 mr1629 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121957619 NA 1.05E-06 mr1671 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121957619 NA 2.99E-07 mr1780 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121957619 NA 2.90E-06 mr1982 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121957619 NA 2.25E-06 mr1220_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121957619 NA 1.31E-06 mr1242_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121957619 NA 9.58E-06 mr1312_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121957619 NA 9.78E-06 mr1359_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121957619 NA 4.02E-07 mr1422_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121957619 NA 7.19E-07 mr1583_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121957619 NA 8.83E-06 mr1621_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121957619 NA 5.44E-06 mr1663_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121957619 2.66E-06 2.66E-06 mr1760_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1121957619 1.40E-06 1.40E-06 mr1822_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251