\
| Variant ID: vg1120489837 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 20489837 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TGCCGAAGAGTGAATTGCTGGAGCCAAGCGAAACGGCAAGCGAAAAGAAATTCGTGAATAAAACTTTTATATACGTATTCTTAGCAATCTAAAAGCAAAG[G/A]
CTGAAAAATAAACTTTGATGAAAAAATCTCAAAATCAACTCCAAATTTAAGATTAAAAATTTAAATTTTGGCTGATAAGCATAAGCATAGGCATATGCTA
TAGCATATGCCTATGCTTATGCTTATCAGCCAAAATTTAAATTTTTAATCTTAAATTTGGAGTTGATTTTGAGATTTTTTCATCAAAGTTTATTTTTCAG[C/T]
CTTTGCTTTTAGATTGCTAAGAATACGTATATAAAAGTTTTATTCACGAATTTCTTTTCGCTTGCCGTTTCGCTTGGCTCCAGCAATTCACTCTTCGGCA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 86.10% | 4.40% | 0.49% | 9.01% | NA |
| All Indica | 2759 | 87.00% | 0.20% | 0.54% | 12.25% | NA |
| All Japonica | 1512 | 81.20% | 13.10% | 0.40% | 5.29% | NA |
| Aus | 269 | 99.60% | 0.00% | 0.00% | 0.37% | NA |
| Indica I | 595 | 75.30% | 0.30% | 0.84% | 23.53% | NA |
| Indica II | 465 | 98.90% | 0.00% | 0.22% | 0.86% | NA |
| Indica III | 913 | 82.30% | 0.30% | 0.77% | 16.65% | NA |
| Indica Intermediate | 786 | 94.30% | 0.10% | 0.25% | 5.34% | NA |
| Temperate Japonica | 767 | 71.20% | 24.00% | 0.78% | 4.04% | NA |
| Tropical Japonica | 504 | 89.50% | 1.00% | 0.00% | 9.52% | NA |
| Japonica Intermediate | 241 | 95.90% | 3.70% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 94.80% | 0.00% | 1.04% | 4.17% | NA |
| Intermediate | 90 | 88.90% | 6.70% | 1.11% | 3.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1120489837 | G -> A | LOC_Os11g34950.2 | upstream_gene_variant ; 1785.0bp to feature; MODIFIER | silent_mutation | Average:74.659; most accessible tissue: Zhenshan97 root, score: 89.596 | N | N | N | N |
| vg1120489837 | G -> A | LOC_Os11g34950.1 | upstream_gene_variant ; 1799.0bp to feature; MODIFIER | silent_mutation | Average:74.659; most accessible tissue: Zhenshan97 root, score: 89.596 | N | N | N | N |
| vg1120489837 | G -> A | LOC_Os11g34960.1 | intron_variant ; MODIFIER | silent_mutation | Average:74.659; most accessible tissue: Zhenshan97 root, score: 89.596 | N | N | N | N |
| vg1120489837 | G -> DEL | N | N | silent_mutation | Average:74.659; most accessible tissue: Zhenshan97 root, score: 89.596 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1120489837 | NA | 1.10E-11 | Heading_date | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg1120489837 | NA | 7.67E-08 | mr1757 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1120489837 | 2.26E-06 | 2.26E-06 | mr1193_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1120489837 | NA | 7.46E-06 | mr1263_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1120489837 | 1.39E-06 | 2.52E-08 | mr1321_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1120489837 | NA | 9.05E-06 | mr1321_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1120489837 | NA | 2.78E-06 | mr1346_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1120489837 | NA | 2.71E-06 | mr1354_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1120489837 | NA | 1.38E-06 | mr1371_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1120489837 | 4.50E-07 | NA | mr1517_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1120489837 | NA | 3.74E-07 | mr1517_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1120489837 | NA | 5.17E-06 | mr1567_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1120489837 | 6.80E-07 | 6.69E-09 | mr1577_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1120489837 | 4.31E-06 | 1.35E-07 | mr1577_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1120489837 | NA | 1.03E-07 | mr1723_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1120489837 | NA | 6.31E-06 | mr1738_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1120489837 | 9.86E-06 | NA | mr1740_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1120489837 | NA | 3.69E-06 | mr1740_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1120489837 | 2.43E-08 | NA | mr1768_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1120489837 | NA | 9.01E-07 | mr1768_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1120489837 | NA | 1.43E-06 | mr1792_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1120489837 | NA | 3.34E-07 | mr1792_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1120489837 | NA | 3.73E-06 | mr1902_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1120489837 | NA | 7.34E-07 | mr1977_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |