Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1120489837:

Variant ID: vg1120489837 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 20489837
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TGCCGAAGAGTGAATTGCTGGAGCCAAGCGAAACGGCAAGCGAAAAGAAATTCGTGAATAAAACTTTTATATACGTATTCTTAGCAATCTAAAAGCAAAG[G/A]
CTGAAAAATAAACTTTGATGAAAAAATCTCAAAATCAACTCCAAATTTAAGATTAAAAATTTAAATTTTGGCTGATAAGCATAAGCATAGGCATATGCTA

Reverse complement sequence

TAGCATATGCCTATGCTTATGCTTATCAGCCAAAATTTAAATTTTTAATCTTAAATTTGGAGTTGATTTTGAGATTTTTTCATCAAAGTTTATTTTTCAG[C/T]
CTTTGCTTTTAGATTGCTAAGAATACGTATATAAAAGTTTTATTCACGAATTTCTTTTCGCTTGCCGTTTCGCTTGGCTCCAGCAATTCACTCTTCGGCA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	86.10%	4.40%	0.49%	9.01%	NA
All Indica	2759	87.00%	0.20%	0.54%	12.25%	NA
All Japonica	1512	81.20%	13.10%	0.40%	5.29%	NA
Aus	269	99.60%	0.00%	0.00%	0.37%	NA
Indica I	595	75.30%	0.30%	0.84%	23.53%	NA
Indica II	465	98.90%	0.00%	0.22%	0.86%	NA
Indica III	913	82.30%	0.30%	0.77%	16.65%	NA
Indica Intermediate	786	94.30%	0.10%	0.25%	5.34%	NA
Temperate Japonica	767	71.20%	24.00%	0.78%	4.04%	NA
Tropical Japonica	504	89.50%	1.00%	0.00%	9.52%	NA
Japonica Intermediate	241	95.90%	3.70%	0.00%	0.41%	NA
VI/Aromatic	96	94.80%	0.00%	1.04%	4.17%	NA
Intermediate	90	88.90%	6.70%	1.11%	3.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1120489837	G -> A	LOC_Os11g34950.2	upstream_gene_variant ; 1785.0bp to feature; MODIFIER	silent_mutation	Average:74.659; most accessible tissue: Zhenshan97 root, score: 89.596	N	N	N	N
vg1120489837	G -> A	LOC_Os11g34950.1	upstream_gene_variant ; 1799.0bp to feature; MODIFIER	silent_mutation	Average:74.659; most accessible tissue: Zhenshan97 root, score: 89.596	N	N	N	N
vg1120489837	G -> A	LOC_Os11g34960.1	intron_variant ; MODIFIER	silent_mutation	Average:74.659; most accessible tissue: Zhenshan97 root, score: 89.596	N	N	N	N
vg1120489837	G -> DEL	N	N	silent_mutation	Average:74.659; most accessible tissue: Zhenshan97 root, score: 89.596	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1120489837	NA	1.10E-11	Heading_date	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1120489837	NA	7.67E-08	mr1757	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120489837	2.26E-06	2.26E-06	mr1193_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120489837	NA	7.46E-06	mr1263_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120489837	1.39E-06	2.52E-08	mr1321_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120489837	NA	9.05E-06	mr1321_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120489837	NA	2.78E-06	mr1346_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120489837	NA	2.71E-06	mr1354_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120489837	NA	1.38E-06	mr1371_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120489837	4.50E-07	NA	mr1517_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120489837	NA	3.74E-07	mr1517_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120489837	NA	5.17E-06	mr1567_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120489837	6.80E-07	6.69E-09	mr1577_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120489837	4.31E-06	1.35E-07	mr1577_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120489837	NA	1.03E-07	mr1723_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120489837	NA	6.31E-06	mr1738_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120489837	9.86E-06	NA	mr1740_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120489837	NA	3.69E-06	mr1740_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120489837	2.43E-08	NA	mr1768_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120489837	NA	9.01E-07	mr1768_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120489837	NA	1.43E-06	mr1792_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120489837	NA	3.34E-07	mr1792_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120489837	NA	3.73E-06	mr1902_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120489837	NA	7.34E-07	mr1977_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251