\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1120489837:

Variant ID: vg1120489837 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 20489837
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGCCGAAGAGTGAATTGCTGGAGCCAAGCGAAACGGCAAGCGAAAAGAAATTCGTGAATAAAACTTTTATATACGTATTCTTAGCAATCTAAAAGCAAAG[G/A]
CTGAAAAATAAACTTTGATGAAAAAATCTCAAAATCAACTCCAAATTTAAGATTAAAAATTTAAATTTTGGCTGATAAGCATAAGCATAGGCATATGCTA

Reverse complement sequence

TAGCATATGCCTATGCTTATGCTTATCAGCCAAAATTTAAATTTTTAATCTTAAATTTGGAGTTGATTTTGAGATTTTTTCATCAAAGTTTATTTTTCAG[C/T]
CTTTGCTTTTAGATTGCTAAGAATACGTATATAAAAGTTTTATTCACGAATTTCTTTTCGCTTGCCGTTTCGCTTGGCTCCAGCAATTCACTCTTCGGCA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 86.10% 4.40% 0.49% 9.01% NA
All Indica  2759 87.00% 0.20% 0.54% 12.25% NA
All Japonica  1512 81.20% 13.10% 0.40% 5.29% NA
Aus  269 99.60% 0.00% 0.00% 0.37% NA
Indica I  595 75.30% 0.30% 0.84% 23.53% NA
Indica II  465 98.90% 0.00% 0.22% 0.86% NA
Indica III  913 82.30% 0.30% 0.77% 16.65% NA
Indica Intermediate  786 94.30% 0.10% 0.25% 5.34% NA
Temperate Japonica  767 71.20% 24.00% 0.78% 4.04% NA
Tropical Japonica  504 89.50% 1.00% 0.00% 9.52% NA
Japonica Intermediate  241 95.90% 3.70% 0.00% 0.41% NA
VI/Aromatic  96 94.80% 0.00% 1.04% 4.17% NA
Intermediate  90 88.90% 6.70% 1.11% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1120489837 G -> A LOC_Os11g34950.2 upstream_gene_variant ; 1785.0bp to feature; MODIFIER silent_mutation Average:74.659; most accessible tissue: Zhenshan97 root, score: 89.596 N N N N
vg1120489837 G -> A LOC_Os11g34950.1 upstream_gene_variant ; 1799.0bp to feature; MODIFIER silent_mutation Average:74.659; most accessible tissue: Zhenshan97 root, score: 89.596 N N N N
vg1120489837 G -> A LOC_Os11g34960.1 intron_variant ; MODIFIER silent_mutation Average:74.659; most accessible tissue: Zhenshan97 root, score: 89.596 N N N N
vg1120489837 G -> DEL N N silent_mutation Average:74.659; most accessible tissue: Zhenshan97 root, score: 89.596 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1120489837 NA 1.10E-11 Heading_date All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1120489837 NA 7.67E-08 mr1757 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120489837 2.26E-06 2.26E-06 mr1193_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120489837 NA 7.46E-06 mr1263_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120489837 1.39E-06 2.52E-08 mr1321_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120489837 NA 9.05E-06 mr1321_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120489837 NA 2.78E-06 mr1346_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120489837 NA 2.71E-06 mr1354_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120489837 NA 1.38E-06 mr1371_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120489837 4.50E-07 NA mr1517_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120489837 NA 3.74E-07 mr1517_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120489837 NA 5.17E-06 mr1567_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120489837 6.80E-07 6.69E-09 mr1577_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120489837 4.31E-06 1.35E-07 mr1577_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120489837 NA 1.03E-07 mr1723_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120489837 NA 6.31E-06 mr1738_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120489837 9.86E-06 NA mr1740_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120489837 NA 3.69E-06 mr1740_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120489837 2.43E-08 NA mr1768_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120489837 NA 9.01E-07 mr1768_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120489837 NA 1.43E-06 mr1792_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120489837 NA 3.34E-07 mr1792_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120489837 NA 3.73E-06 mr1902_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120489837 NA 7.34E-07 mr1977_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251