\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1120474541:

Variant ID: vg1120474541 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 20474541
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AGGGCTAAGTCAAGATTTTCACTTAACACCATGTTTCTTTGCCAAGAGTTGCACTTTGGGGCAGGGTATGTTCATGATCTGGGCATGTGTGACCTCACCG[T/C]
TGATATTCTGCTGCTGTGGCTCTTCACTGTGCGATTGCTGTGTATTTCATTGTGATGGTGATGCTCGACCTCCACGTGATCGGCGGCATCCAACTGGGGA

Reverse complement sequence

TCCCCAGTTGGATGCCGCCGATCACGTGGAGGTCGAGCATCACCATCACAATGAAATACACAGCAATCGCACAGTGAAGAGCCACAGCAGCAGAATATCA[A/G]
CGGTGAGGTCACACATGCCCAGATCATGAACATACCCTGCCCCAAAGTGCAACTCTTGGCAAAGAAACATGGTGTTAAGTGAAAATCTTGACTTAGCCCT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 73.10% 4.30% 0.99% 21.60% NA
All Indica  2759 69.10% 0.20% 0.62% 30.08% NA
All Japonica  1512 81.90% 12.60% 1.52% 3.97% NA
Aus  269 56.50% 0.00% 2.60% 40.89% NA
Indica I  595 52.40% 0.30% 1.34% 45.88% NA
Indica II  465 78.90% 0.00% 0.86% 20.22% NA
Indica III  913 67.30% 0.30% 0.44% 31.98% NA
Indica Intermediate  786 78.00% 0.10% 0.13% 21.76% NA
Temperate Japonica  767 73.10% 23.10% 2.87% 0.91% NA
Tropical Japonica  504 89.10% 1.00% 0.20% 9.72% NA
Japonica Intermediate  241 95.00% 3.30% 0.00% 1.66% NA
VI/Aromatic  96 86.50% 0.00% 0.00% 13.54% NA
Intermediate  90 82.20% 8.90% 0.00% 8.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1120474541 T -> DEL N N silent_mutation Average:39.298; most accessible tissue: Callus, score: 69.666 N N N N
vg1120474541 T -> C LOC_Os11g34930.1 upstream_gene_variant ; 4039.0bp to feature; MODIFIER silent_mutation Average:39.298; most accessible tissue: Callus, score: 69.666 N N N N
vg1120474541 T -> C LOC_Os11g34940.1 downstream_gene_variant ; 3635.0bp to feature; MODIFIER silent_mutation Average:39.298; most accessible tissue: Callus, score: 69.666 N N N N
vg1120474541 T -> C LOC_Os11g34930-LOC_Os11g34940 intergenic_region ; MODIFIER silent_mutation Average:39.298; most accessible tissue: Callus, score: 69.666 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1120474541 NA 2.97E-10 Heading_date All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1120474541 NA 1.76E-06 mr1354 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120474541 NA 2.63E-08 mr1031_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120474541 2.19E-06 2.19E-06 mr1193_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120474541 9.78E-06 2.06E-07 mr1321_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120474541 NA 4.06E-06 mr1321_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120474541 NA 5.00E-07 mr1354_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120474541 NA 2.03E-06 mr1371_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120474541 9.24E-09 NA mr1517_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120474541 NA 1.64E-07 mr1517_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120474541 4.51E-06 NA mr1538_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120474541 8.88E-06 NA mr1539_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120474541 NA 4.26E-06 mr1567_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120474541 4.29E-06 1.26E-07 mr1577_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120474541 NA 7.67E-07 mr1577_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120474541 NA 2.75E-07 mr1723_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120474541 1.76E-09 NA mr1768_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120474541 NA 7.02E-08 mr1768_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120474541 NA 4.17E-06 mr1792_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120474541 NA 2.72E-06 mr1829_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120474541 NA 9.69E-06 mr1865_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120474541 NA 3.25E-07 mr1902_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1120474541 NA 2.50E-06 mr1977_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251