\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1118152458:

Variant ID: vg1118152458 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 18152458
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.78, T: 0.22, others allele: 0.00, population size: 81. )

Flanking Sequence (100 bp) in Reference Genome:


CCTGCACCGACTCCTCCTCAGGCTCCTGCACCGACTCCTCCTCGGGCTCCTACACCGACTCCTCCGCAAGCTCCTCTTCCGGCACCTTCAAAGTCAAAGG[T/C]
CCCCCAAGCTCCACCGCCTGCCCACACAAGGGCAATGAAGAAGGCGAAAGTTGACGCCGCCAAGAACAAGGATCCGGGGTACGATTGCACGCAAAAGGAG

Reverse complement sequence

CTCCTTTTGCGTGCAATCGTACCCCGGATCCTTGTTCTTGGCGGCGTCAACTTTCGCCTTCTTCATTGCCCTTGTGTGGGCAGGCGGTGGAGCTTGGGGG[A/G]
CCTTTGACTTTGAAGGTGCCGGAAGAGGAGCTTGCGGAGGAGTCGGTGTAGGAGCCCGAGGAGGAGTCGGTGCAGGAGCCTGAGGAGGAGTCGGTGCAGG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 65.00% 24.00% 3.70% 7.24% NA
All Indica  2759 84.30% 8.70% 5.36% 1.67% NA
All Japonica  1512 26.70% 53.70% 0.86% 18.78% NA
Aus  269 84.40% 14.50% 0.00% 1.12% NA
Indica I  595 77.00% 18.70% 4.37% 0.00% NA
Indica II  465 71.80% 7.50% 18.06% 2.58% NA
Indica III  913 93.80% 3.50% 0.00% 2.74% NA
Indica Intermediate  786 86.10% 7.90% 4.83% 1.15% NA
Temperate Japonica  767 3.80% 92.30% 1.04% 2.87% NA
Tropical Japonica  504 44.40% 4.60% 0.60% 50.40% NA
Japonica Intermediate  241 62.20% 33.60% 0.83% 3.32% NA
VI/Aromatic  96 66.70% 31.20% 1.04% 1.04% NA
Intermediate  90 61.10% 15.60% 14.44% 8.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1118152458 T -> DEL LOC_Os11g31180.1 N frameshift_variant Average:48.337; most accessible tissue: Minghui63 young leaf, score: 65.92 N N N N
vg1118152458 T -> C LOC_Os11g31180.1 missense_variant ; p.Val515Ala; MODERATE frameshift_variant Average:48.337; most accessible tissue: Minghui63 young leaf, score: 65.92 N N N N
vg1118152458 T -> C LOC_Os11g31180.1 missense_variant ; p.Val515Ala; MODERATE nonsynonymous_codon ; V515T Average:48.337; most accessible tissue: Minghui63 young leaf, score: 65.92 benign 0.118 DELETERIOUS 0.00
vg1118152458 T -> C LOC_Os11g31180.1 missense_variant ; p.Val515Ala; MODERATE nonsynonymous_codon ; V515A Average:48.337; most accessible tissue: Minghui63 young leaf, score: 65.92 benign -1.453 TOLERATED 1.00

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1118152458 NA 2.21E-10 Heading_date All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1118152458 NA 1.39E-07 mr1002 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118152458 NA 2.14E-10 mr1002_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118152458 7.78E-06 8.30E-12 mr1002_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118152458 NA 6.94E-20 mr1156_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118152458 NA 2.66E-08 mr1156_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118152458 NA 3.83E-07 mr1159_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118152458 NA 3.71E-07 mr1350_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118152458 NA 2.59E-06 mr1358_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118152458 NA 7.34E-06 mr1359_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118152458 NA 1.16E-08 mr1378_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118152458 NA 5.22E-11 mr1546_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118152458 NA 5.10E-08 mr1576_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118152458 NA 7.72E-10 mr1624_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118152458 NA 1.24E-08 mr1645_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118152458 NA 9.76E-06 mr1647_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118152458 NA 3.62E-06 mr1648_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118152458 NA 1.12E-06 mr1669_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118152458 NA 2.27E-06 mr1682_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118152458 NA 2.72E-10 mr1864_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1118152458 NA 1.64E-06 mr1977_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251