\
| Variant ID: vg1117693473 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 17693473 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.03, others allele: 0.00, population size: 116. )
AACCGGGACTAAAAATGATCTTTATTCCCGGTTGGTGTTACCAACCGGGACTAAAGATCAAAATTTTTTTAACCGGAACTAAAAATGATCTTTAGTCCCG[G/A]
TTTTATTGCAACCGAGACTATTGTGAAATTTAGTCGACCGACCAAATATGATTTCTCCACCAGTGGTAGCAAGTATACACCGTATACTCCGTGGACATGG
CCATGTCCACGGAGTATACGGTGTATACTTGCTACCACTGGTGGAGAAATCATATTTGGTCGGTCGACTAAATTTCACAATAGTCTCGGTTGCAATAAAA[C/T]
CGGGACTAAAGATCATTTTTAGTTCCGGTTAAAAAAATTTTGATCTTTAGTCCCGGTTGGTAACACCAACCGGGAATAAAGATCATTTTTAGTCCCGGTT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 76.70% | 23.20% | 0.04% | 0.00% | NA |
| All Indica | 2759 | 74.80% | 25.20% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 77.20% | 22.80% | 0.00% | 0.00% | NA |
| Aus | 269 | 87.00% | 12.60% | 0.37% | 0.00% | NA |
| Indica I | 595 | 96.60% | 3.40% | 0.00% | 0.00% | NA |
| Indica II | 465 | 53.50% | 46.50% | 0.00% | 0.00% | NA |
| Indica III | 913 | 73.40% | 26.50% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 72.50% | 27.50% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 98.40% | 1.60% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 39.90% | 60.10% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 87.60% | 12.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 73.30% | 26.70% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1117693473 | G -> A | LOC_Os11g30430.1 | upstream_gene_variant ; 1384.0bp to feature; MODIFIER | silent_mutation | Average:61.628; most accessible tissue: Zhenshan97 panicle, score: 79.799 | N | N | N | N |
| vg1117693473 | G -> A | LOC_Os11g30410-LOC_Os11g30430 | intergenic_region ; MODIFIER | silent_mutation | Average:61.628; most accessible tissue: Zhenshan97 panicle, score: 79.799 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1117693473 | NA | 2.37E-14 | Grain_length | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg1117693473 | NA | 1.91E-09 | mr1016 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117693473 | NA | 1.47E-09 | mr1018 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117693473 | NA | 3.84E-09 | mr1019 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117693473 | NA | 1.56E-06 | mr1050 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117693473 | NA | 4.45E-11 | mr1055 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117693473 | NA | 2.65E-06 | mr1155 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117693473 | NA | 1.20E-07 | mr1271 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117693473 | NA | 8.88E-06 | mr1378 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117693473 | NA | 2.46E-06 | mr1422 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117693473 | NA | 1.11E-06 | mr1543 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117693473 | NA | 4.11E-11 | mr1668 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117693473 | NA | 5.54E-08 | mr1668 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117693473 | NA | 5.36E-13 | mr1769 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117693473 | NA | 6.05E-06 | mr1887 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117693473 | NA | 3.30E-07 | mr1951 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117693473 | NA | 3.16E-10 | mr1019_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117693473 | NA | 4.59E-10 | mr1347_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117693473 | NA | 1.15E-06 | mr1629_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |