Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1117595503:

Variant ID: vg1117595503 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 17595503
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GCTCGGTGGCCGTGCGGCGGACTGACGCTGGGGCGCACAGCTATCCTGCCATGTGCGAAGAAGAGAGGGGAAAAATCAGAAAGGGGAAAAGTGGCGAGGA[G/A]
AATGAGGCGGCAGGGGGTGGGGAAGTGAGGGGATCGATTAAAAGGGCTAGGGTTTTGTTGGTCTCTATTTTGGGCTGACATATGGGCCTTCGGCTGTAAC

Reverse complement sequence

GTTACAGCCGAAGGCCCATATGTCAGCCCAAAATAGAGACCAACAAAACCCTAGCCCTTTTAATCGATCCCCTCACTTCCCCACCCCCTGCCGCCTCATT[C/T]
TCCTCGCCACTTTTCCCCTTTCTGATTTTTCCCCTCTCTTCTTCGCACATGGCAGGATAGCTGTGCGCCCCAGCGTCAGTCCGCCGCACGGCCACCGAGC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	65.10%	5.20%	7.13%	22.51%	NA
All Indica	2759	62.30%	0.00%	10.29%	27.33%	NA
All Japonica	1512	67.60%	16.00%	1.12%	15.28%	NA
Aus	269	79.90%	0.00%	5.95%	14.13%	NA
Indica I	595	59.80%	0.00%	21.01%	19.16%	NA
Indica II	465	63.40%	0.00%	13.33%	23.23%	NA
Indica III	913	60.90%	0.00%	1.42%	37.68%	NA
Indica Intermediate	786	65.30%	0.10%	10.69%	23.92%	NA
Temperate Japonica	767	67.10%	30.50%	0.26%	2.09%	NA
Tropical Japonica	504	59.70%	0.40%	2.38%	37.50%	NA
Japonica Intermediate	241	85.50%	2.50%	1.24%	10.79%	NA
VI/Aromatic	96	70.80%	1.00%	10.42%	17.71%	NA
Intermediate	90	58.90%	3.30%	11.11%	26.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1117595503	G -> A	LOC_Os11g30270.1	upstream_gene_variant ; 2464.0bp to feature; MODIFIER	silent_mutation	Average:16.347; most accessible tissue: Zhenshan97 panicle, score: 49.416	N	N	N	N
vg1117595503	G -> A	LOC_Os11g30280.1	upstream_gene_variant ; 749.0bp to feature; MODIFIER	silent_mutation	Average:16.347; most accessible tissue: Zhenshan97 panicle, score: 49.416	N	N	N	N
vg1117595503	G -> A	LOC_Os11g30290.1	downstream_gene_variant ; 997.0bp to feature; MODIFIER	silent_mutation	Average:16.347; most accessible tissue: Zhenshan97 panicle, score: 49.416	N	N	N	N
vg1117595503	G -> A	LOC_Os11g30300.1	downstream_gene_variant ; 3428.0bp to feature; MODIFIER	silent_mutation	Average:16.347; most accessible tissue: Zhenshan97 panicle, score: 49.416	N	N	N	N
vg1117595503	G -> A	LOC_Os11g30310.1	downstream_gene_variant ; 4427.0bp to feature; MODIFIER	silent_mutation	Average:16.347; most accessible tissue: Zhenshan97 panicle, score: 49.416	N	N	N	N
vg1117595503	G -> A	LOC_Os11g30280-LOC_Os11g30290	intergenic_region ; MODIFIER	silent_mutation	Average:16.347; most accessible tissue: Zhenshan97 panicle, score: 49.416	N	N	N	N
vg1117595503	G -> DEL	N	N	silent_mutation	Average:16.347; most accessible tissue: Zhenshan97 panicle, score: 49.416	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1117595503	NA	8.82E-13	Heading_date	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1117595503	NA	5.91E-11	Heading_date	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1117595503	NA	4.95E-06	mr1138	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117595503	5.50E-08	6.60E-10	mr1343	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117595503	5.16E-07	5.16E-07	mr1343	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117595503	9.03E-07	NA	mr1354	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117595503	NA	3.77E-11	mr1354	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117595503	9.48E-10	1.26E-12	mr1829	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117595503	NA	4.04E-10	mr1829	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117595503	NA	5.78E-12	mr1902	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117595503	NA	8.34E-07	mr1902	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117595503	NA	3.89E-07	mr1138_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117595503	1.90E-08	7.79E-10	mr1354_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117595503	NA	1.41E-13	mr1354_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117595503	5.66E-06	NA	mr1679_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117595503	1.50E-11	2.76E-16	mr1829_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117595503	NA	1.18E-10	mr1829_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117595503	9.51E-06	NA	mr1842_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117595503	3.60E-09	4.70E-20	mr1902_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117595503	NA	6.09E-11	mr1902_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251