\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1117591563:

Variant ID: vg1117591563 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 17591563
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGTGTCCAATGGTGATCCTTGCCATAGCCTACAAACTTATCTCCATTAGCAGCAGGGACAAGGTTATCTAACCGGGCACGGATCTCTTGACCTAAGAGAC[G/A]
AAGAGGTGGTTCATTGCTAACTGTAGTGTTTGATAGAAAAGAATGTGAATCACTTCTAAAACTATGATCAATTGGGAGGAACTGGCGATGACAATCAAAG

Reverse complement sequence

CTTTGATTGTCATCGCCAGTTCCTCCCAATTGATCATAGTTTTAGAAGTGATTCACATTCTTTTCTATCAAACACTACAGTTAGCAATGAACCACCTCTT[C/T]
GTCTCTTAGGTCAAGAGATCCGTGCCCGGTTAGATAACCTTGTCCCTGCTGCTAATGGAGATAAGTTTGTAGGCTATGGCAAGGATCACCATTGGACACA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 33.30% 5.20% 8.32% 53.20% NA
All Indica  2759 15.90% 0.00% 8.34% 75.72% NA
All Japonica  1512 66.70% 15.90% 0.20% 17.20% NA
Aus  269 12.30% 0.00% 53.16% 34.57% NA
Indica I  595 15.50% 0.00% 4.37% 80.17% NA
Indica II  465 3.90% 0.00% 11.83% 84.30% NA
Indica III  913 20.00% 0.00% 7.12% 72.84% NA
Indica Intermediate  786 18.60% 0.10% 10.69% 70.61% NA
Temperate Japonica  767 67.10% 30.40% 0.00% 2.48% NA
Tropical Japonica  504 57.50% 0.40% 0.60% 41.47% NA
Japonica Intermediate  241 84.20% 2.50% 0.00% 13.28% NA
VI/Aromatic  96 57.30% 1.00% 8.33% 33.33% NA
Intermediate  90 41.10% 4.40% 10.00% 44.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1117591563 G -> A LOC_Os11g30270.1 missense_variant ; p.Arg493Cys; MODERATE nonsynonymous_codon ; R493C Average:10.117; most accessible tissue: Callus, score: 16.624 probably damaging 3.16 TOLERATED 0.13
vg1117591563 G -> DEL LOC_Os11g30270.1 N frameshift_variant Average:10.117; most accessible tissue: Callus, score: 16.624 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1117591563 NA 3.91E-10 Heading_date All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1117591563 2.74E-06 1.48E-08 mr1343 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117591563 1.50E-06 1.50E-06 mr1343 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117591563 4.21E-07 1.78E-07 mr1354 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117591563 NA 2.54E-10 mr1354 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117591563 2.25E-11 1.93E-14 mr1829 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117591563 NA 1.44E-09 mr1829 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117591563 NA 5.16E-12 mr1902 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117591563 NA 1.55E-06 mr1902 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117591563 NA 6.05E-07 mr1138_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117591563 4.25E-08 1.57E-09 mr1354_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117591563 NA 2.99E-13 mr1354_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117591563 NA 9.66E-06 mr1371_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117591563 6.45E-06 2.57E-06 mr1499_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117591563 NA 3.15E-06 mr1647_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117591563 7.19E-10 4.95E-15 mr1829_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117591563 NA 3.84E-10 mr1829_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117591563 2.54E-08 2.34E-19 mr1902_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117591563 NA 1.36E-10 mr1902_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251