Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1117591563:

Variant ID: vg1117591563 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 17591563
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TGTGTCCAATGGTGATCCTTGCCATAGCCTACAAACTTATCTCCATTAGCAGCAGGGACAAGGTTATCTAACCGGGCACGGATCTCTTGACCTAAGAGAC[G/A]
AAGAGGTGGTTCATTGCTAACTGTAGTGTTTGATAGAAAAGAATGTGAATCACTTCTAAAACTATGATCAATTGGGAGGAACTGGCGATGACAATCAAAG

Reverse complement sequence

CTTTGATTGTCATCGCCAGTTCCTCCCAATTGATCATAGTTTTAGAAGTGATTCACATTCTTTTCTATCAAACACTACAGTTAGCAATGAACCACCTCTT[C/T]
GTCTCTTAGGTCAAGAGATCCGTGCCCGGTTAGATAACCTTGTCCCTGCTGCTAATGGAGATAAGTTTGTAGGCTATGGCAAGGATCACCATTGGACACA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	33.30%	5.20%	8.32%	53.20%	NA
All Indica	2759	15.90%	0.00%	8.34%	75.72%	NA
All Japonica	1512	66.70%	15.90%	0.20%	17.20%	NA
Aus	269	12.30%	0.00%	53.16%	34.57%	NA
Indica I	595	15.50%	0.00%	4.37%	80.17%	NA
Indica II	465	3.90%	0.00%	11.83%	84.30%	NA
Indica III	913	20.00%	0.00%	7.12%	72.84%	NA
Indica Intermediate	786	18.60%	0.10%	10.69%	70.61%	NA
Temperate Japonica	767	67.10%	30.40%	0.00%	2.48%	NA
Tropical Japonica	504	57.50%	0.40%	0.60%	41.47%	NA
Japonica Intermediate	241	84.20%	2.50%	0.00%	13.28%	NA
VI/Aromatic	96	57.30%	1.00%	8.33%	33.33%	NA
Intermediate	90	41.10%	4.40%	10.00%	44.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1117591563	G -> A	LOC_Os11g30270.1	missense_variant ; p.Arg493Cys; MODERATE	nonsynonymous_codon ; R493C	Average:10.117; most accessible tissue: Callus, score: 16.624	probably damaging	3.16	TOLERATED	0.13
vg1117591563	G -> DEL	LOC_Os11g30270.1	N	frameshift_variant	Average:10.117; most accessible tissue: Callus, score: 16.624	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1117591563	NA	3.91E-10	Heading_date	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1117591563	2.74E-06	1.48E-08	mr1343	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117591563	1.50E-06	1.50E-06	mr1343	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117591563	4.21E-07	1.78E-07	mr1354	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117591563	NA	2.54E-10	mr1354	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117591563	2.25E-11	1.93E-14	mr1829	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117591563	NA	1.44E-09	mr1829	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117591563	NA	5.16E-12	mr1902	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117591563	NA	1.55E-06	mr1902	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117591563	NA	6.05E-07	mr1138_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117591563	4.25E-08	1.57E-09	mr1354_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117591563	NA	2.99E-13	mr1354_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117591563	NA	9.66E-06	mr1371_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117591563	6.45E-06	2.57E-06	mr1499_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117591563	NA	3.15E-06	mr1647_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117591563	7.19E-10	4.95E-15	mr1829_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117591563	NA	3.84E-10	mr1829_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117591563	2.54E-08	2.34E-19	mr1902_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117591563	NA	1.36E-10	mr1902_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251