\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1117530773:

Variant ID: vg1117530773 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 17530773
Reference Allele: AAlternative Allele: G,T
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAAGGTATAAATGAAATTAAATAAATCCCTTGTGATGAATTTTCCCTTAATACTTAGTGAGTTTGACTCAATGCCGCTGTGCATGTTTCTAACTCATTAC[A/G,T]
GGAAACTCGCACTGTCCAAACGGTAGCAAAGAGGGGAGTGAACACTCAGAGTAACTGATGGAGTGAAGATGAAAGTGAAGGGTTGTTGGAGACCTCACAC

Reverse complement sequence

GTGTGAGGTCTCCAACAACCCTTCACTTTCATCTTCACTCCATCAGTTACTCTGAGTGTTCACTCCCCTCTTTGCTACCGTTTGGACAGTGCGAGTTTCC[T/C,A]
GTAATGAGTTAGAAACATGCACAGCGGCATTGAGTCAAACTCACTAAGTATTAAGGGAAAATTCATCACAAGGGATTTATTTAATTTCATTTATACCTTT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 90.90% 5.10% 0.57% 3.32% T: 0.08%
All Indica  2759 99.50% 0.00% 0.36% 0.11% NA
All Japonica  1512 73.00% 15.70% 0.93% 10.05% T: 0.26%
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.70% 0.00% 0.17% 0.17% NA
Indica II  465 98.90% 0.00% 1.08% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.20% 0.00% 0.51% 0.25% NA
Temperate Japonica  767 68.80% 30.00% 0.52% 0.65% NA
Tropical Japonica  504 71.60% 0.40% 1.39% 26.39% T: 0.20%
Japonica Intermediate  241 89.20% 2.50% 1.24% 5.81% T: 1.24%
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 91.10% 3.30% 3.33% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1117530773 A -> T LOC_Os11g30150.1 downstream_gene_variant ; 184.0bp to feature; MODIFIER silent_mutation Average:9.159; most accessible tissue: Callus, score: 37.79 N N N N
vg1117530773 A -> T LOC_Os11g30150-LOC_Os11g30170 intergenic_region ; MODIFIER silent_mutation Average:9.159; most accessible tissue: Callus, score: 37.79 N N N N
vg1117530773 A -> DEL N N silent_mutation Average:9.159; most accessible tissue: Callus, score: 37.79 N N N N
vg1117530773 A -> G LOC_Os11g30150.1 downstream_gene_variant ; 184.0bp to feature; MODIFIER silent_mutation Average:9.159; most accessible tissue: Callus, score: 37.79 N N N N
vg1117530773 A -> G LOC_Os11g30150-LOC_Os11g30170 intergenic_region ; MODIFIER silent_mutation Average:9.159; most accessible tissue: Callus, score: 37.79 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1117530773 NA 1.04E-09 Heading_date All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1117530773 NA 1.82E-07 mr1343 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117530773 1.50E-06 1.50E-06 mr1343 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117530773 1.15E-06 NA mr1354 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117530773 NA 2.54E-10 mr1354 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117530773 1.76E-08 6.63E-11 mr1829 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117530773 NA 1.44E-09 mr1829 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117530773 NA 1.55E-06 mr1902 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117530773 NA 6.05E-07 mr1138_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117530773 NA 8.45E-07 mr1321_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117530773 8.58E-09 6.29E-10 mr1354_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117530773 NA 2.99E-13 mr1354_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117530773 6.08E-10 6.94E-14 mr1829_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117530773 NA 3.84E-10 mr1829_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117530773 2.05E-08 1.89E-18 mr1902_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117530773 NA 1.36E-10 mr1902_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251