Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1117530773:

Variant ID: vg1117530773 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 17530773
Reference Allele: A	Alternative Allele: G,T
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AAAGGTATAAATGAAATTAAATAAATCCCTTGTGATGAATTTTCCCTTAATACTTAGTGAGTTTGACTCAATGCCGCTGTGCATGTTTCTAACTCATTAC[A/G,T]
GGAAACTCGCACTGTCCAAACGGTAGCAAAGAGGGGAGTGAACACTCAGAGTAACTGATGGAGTGAAGATGAAAGTGAAGGGTTGTTGGAGACCTCACAC

Reverse complement sequence

GTGTGAGGTCTCCAACAACCCTTCACTTTCATCTTCACTCCATCAGTTACTCTGAGTGTTCACTCCCCTCTTTGCTACCGTTTGGACAGTGCGAGTTTCC[T/C,A]
GTAATGAGTTAGAAACATGCACAGCGGCATTGAGTCAAACTCACTAAGTATTAAGGGAAAATTCATCACAAGGGATTTATTTAATTTCATTTATACCTTT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	90.90%	5.10%	0.57%	3.32%	T: 0.08%
All Indica	2759	99.50%	0.00%	0.36%	0.11%	NA
All Japonica	1512	73.00%	15.70%	0.93%	10.05%	T: 0.26%
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	99.70%	0.00%	0.17%	0.17%	NA
Indica II	465	98.90%	0.00%	1.08%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	99.20%	0.00%	0.51%	0.25%	NA
Temperate Japonica	767	68.80%	30.00%	0.52%	0.65%	NA
Tropical Japonica	504	71.60%	0.40%	1.39%	26.39%	T: 0.20%
Japonica Intermediate	241	89.20%	2.50%	1.24%	5.81%	T: 1.24%
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	91.10%	3.30%	3.33%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1117530773	A -> T	LOC_Os11g30150.1	downstream_gene_variant ; 184.0bp to feature; MODIFIER	silent_mutation	Average:9.159; most accessible tissue: Callus, score: 37.79	N	N	N	N
vg1117530773	A -> T	LOC_Os11g30150-LOC_Os11g30170	intergenic_region ; MODIFIER	silent_mutation	Average:9.159; most accessible tissue: Callus, score: 37.79	N	N	N	N
vg1117530773	A -> DEL	N	N	silent_mutation	Average:9.159; most accessible tissue: Callus, score: 37.79	N	N	N	N
vg1117530773	A -> G	LOC_Os11g30150.1	downstream_gene_variant ; 184.0bp to feature; MODIFIER	silent_mutation	Average:9.159; most accessible tissue: Callus, score: 37.79	N	N	N	N
vg1117530773	A -> G	LOC_Os11g30150-LOC_Os11g30170	intergenic_region ; MODIFIER	silent_mutation	Average:9.159; most accessible tissue: Callus, score: 37.79	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1117530773	NA	1.04E-09	Heading_date	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1117530773	NA	1.82E-07	mr1343	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117530773	1.50E-06	1.50E-06	mr1343	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117530773	1.15E-06	NA	mr1354	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117530773	NA	2.54E-10	mr1354	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117530773	1.76E-08	6.63E-11	mr1829	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117530773	NA	1.44E-09	mr1829	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117530773	NA	1.55E-06	mr1902	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117530773	NA	6.05E-07	mr1138_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117530773	NA	8.45E-07	mr1321_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117530773	8.58E-09	6.29E-10	mr1354_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117530773	NA	2.99E-13	mr1354_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117530773	6.08E-10	6.94E-14	mr1829_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117530773	NA	3.84E-10	mr1829_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117530773	2.05E-08	1.89E-18	mr1902_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117530773	NA	1.36E-10	mr1902_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251