\
| Variant ID: vg1117527349 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 17527349 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
TTCCGCATAAGTAAGAGGTGATTGTTTGTAGACTAAAGCCTAATATCCTGTAATAAGAACTCCAACATTGTGGTATCAGAGCTGATCTTTAGTCCACTCA[A/G]
TCCCTCATAATCACATCATCCCTGTGATTAGAAGCCATCCCTAAAAAAAGGTTCAAGATTGATTCGGCATGAACAATTTTGAATTAGATTAGATTAATTT
AAATTAATCTAATCTAATTCAAAATTGTTCATGCCGAATCAATCTTGAACCTTTTTTTAGGGATGGCTTCTAATCACAGGGATGATGTGATTATGAGGGA[T/C]
TGAGTGGACTAAAGATCAGCTCTGATACCACAATGTTGGAGTTCTTATTACAGGATATTAGGCTTTAGTCTACAAACAATCACCTCTTACTTATGCGGAA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 52.10% | 5.20% | 1.33% | 41.35% | NA |
| All Indica | 2759 | 38.60% | 0.00% | 1.70% | 59.70% | NA |
| All Japonica | 1512 | 67.70% | 15.90% | 0.40% | 15.94% | NA |
| Aus | 269 | 90.00% | 0.00% | 0.37% | 9.67% | NA |
| Indica I | 595 | 32.60% | 0.00% | 1.34% | 66.05% | NA |
| Indica II | 465 | 39.10% | 0.20% | 1.94% | 58.71% | NA |
| Indica III | 913 | 39.90% | 0.00% | 1.20% | 58.93% | NA |
| Indica Intermediate | 786 | 41.20% | 0.00% | 2.42% | 56.36% | NA |
| Temperate Japonica | 767 | 67.40% | 30.40% | 0.13% | 2.09% | NA |
| Tropical Japonica | 504 | 59.90% | 0.40% | 0.99% | 38.69% | NA |
| Japonica Intermediate | 241 | 85.10% | 2.50% | 0.00% | 12.45% | NA |
| VI/Aromatic | 96 | 78.10% | 1.00% | 8.33% | 12.50% | NA |
| Intermediate | 90 | 63.30% | 4.40% | 1.11% | 31.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1117527349 | A -> DEL | N | N | silent_mutation | Average:21.071; most accessible tissue: Minghui63 root, score: 43.505 | N | N | N | N |
| vg1117527349 | A -> G | LOC_Os11g30150.1 | intron_variant ; MODIFIER | silent_mutation | Average:21.071; most accessible tissue: Minghui63 root, score: 43.505 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1117527349 | NA | 8.79E-10 | Heading_date | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg1117527349 | NA | 1.20E-07 | mr1343 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117527349 | 1.50E-06 | 1.50E-06 | mr1343 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117527349 | NA | 2.54E-10 | mr1354 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117527349 | 9.76E-06 | NA | mr1525 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117527349 | 1.05E-07 | 5.26E-11 | mr1829 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117527349 | NA | 1.44E-09 | mr1829 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117527349 | NA | 1.55E-06 | mr1902 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117527349 | NA | 6.05E-07 | mr1138_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117527349 | 3.66E-07 | 4.67E-09 | mr1354_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117527349 | NA | 2.99E-13 | mr1354_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117527349 | NA | 9.20E-06 | mr1499_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117527349 | NA | 3.33E-06 | mr1647_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117527349 | 8.18E-09 | 4.20E-14 | mr1829_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117527349 | NA | 3.84E-10 | mr1829_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117527349 | 6.19E-07 | 4.41E-18 | mr1902_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117527349 | NA | 1.36E-10 | mr1902_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |