\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1117272721:

Variant ID: vg1117272721 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 17272721
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.80, T: 0.20, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:


TATTCTAATCCATCGGATAGTCCAAATTCATATCAAACAATCCGATATTTTTGAGAGCAAGATTTCATTCTGAAACAGAGACTCCAGTTCCAAGGAATTT[C/T]
AGAGTCTCTAAGTCATTGGACTATCTGATCCAAATTCAGATACTCTGATTTGCACTTTAGAGAAAATTTTCACTTGGGAGAATATTTCAATTCAAGATAG

Reverse complement sequence

CTATCTTGAATTGAAATATTCTCCCAAGTGAAAATTTTCTCTAAAGTGCAAATCAGAGTATCTGAATTTGGATCAGATAGTCCAATGACTTAGAGACTCT[G/A]
AAATTCCTTGGAACTGGAGTCTCTGTTTCAGAATGAAATCTTGCTCTCAAAAATATCGGATTGTTTGATATGAATTTGGACTATCCGATGGATTAGAATA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 80.90% 18.90% 0.21% 0.00% NA
All Indica  2759 77.00% 22.70% 0.36% 0.00% NA
All Japonica  1512 88.20% 11.80% 0.00% 0.00% NA
Aus  269 78.80% 21.20% 0.00% 0.00% NA
Indica I  595 71.90% 27.70% 0.34% 0.00% NA
Indica II  465 75.90% 23.40% 0.65% 0.00% NA
Indica III  913 83.10% 16.50% 0.33% 0.00% NA
Indica Intermediate  786 74.30% 25.40% 0.25% 0.00% NA
Temperate Japonica  767 98.30% 1.70% 0.00% 0.00% NA
Tropical Japonica  504 71.60% 28.40% 0.00% 0.00% NA
Japonica Intermediate  241 90.50% 9.50% 0.00% 0.00% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 66.70% 33.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1117272721 C -> T LOC_Os11g29760.1 downstream_gene_variant ; 3429.0bp to feature; MODIFIER silent_mutation Average:32.202; most accessible tissue: Callus, score: 60.472 N N N N
vg1117272721 C -> T LOC_Os11g29770.1 downstream_gene_variant ; 612.0bp to feature; MODIFIER silent_mutation Average:32.202; most accessible tissue: Callus, score: 60.472 N N N N
vg1117272721 C -> T LOC_Os11g29760-LOC_Os11g29770 intergenic_region ; MODIFIER silent_mutation Average:32.202; most accessible tissue: Callus, score: 60.472 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1117272721 NA 9.57E-16 Grain_length All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1117272721 NA 1.26E-14 Grain_length Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1117272721 NA 1.74E-09 mr1157 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117272721 NA 1.29E-07 mr1229 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117272721 NA 2.25E-07 mr1328 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117272721 NA 6.35E-09 mr1446 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117272721 NA 3.72E-15 mr1539 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117272721 NA 4.03E-19 mr1540 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117272721 NA 6.24E-21 mr1732 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117272721 NA 3.65E-07 mr1763 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117272721 NA 5.72E-06 mr1871 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1117272721 NA 1.76E-06 mr1582_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251