\
| Variant ID: vg1117272721 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 17272721 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.80, T: 0.20, others allele: 0.00, population size: 103. )
TATTCTAATCCATCGGATAGTCCAAATTCATATCAAACAATCCGATATTTTTGAGAGCAAGATTTCATTCTGAAACAGAGACTCCAGTTCCAAGGAATTT[C/T]
AGAGTCTCTAAGTCATTGGACTATCTGATCCAAATTCAGATACTCTGATTTGCACTTTAGAGAAAATTTTCACTTGGGAGAATATTTCAATTCAAGATAG
CTATCTTGAATTGAAATATTCTCCCAAGTGAAAATTTTCTCTAAAGTGCAAATCAGAGTATCTGAATTTGGATCAGATAGTCCAATGACTTAGAGACTCT[G/A]
AAATTCCTTGGAACTGGAGTCTCTGTTTCAGAATGAAATCTTGCTCTCAAAAATATCGGATTGTTTGATATGAATTTGGACTATCCGATGGATTAGAATA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 80.90% | 18.90% | 0.21% | 0.00% | NA |
| All Indica | 2759 | 77.00% | 22.70% | 0.36% | 0.00% | NA |
| All Japonica | 1512 | 88.20% | 11.80% | 0.00% | 0.00% | NA |
| Aus | 269 | 78.80% | 21.20% | 0.00% | 0.00% | NA |
| Indica I | 595 | 71.90% | 27.70% | 0.34% | 0.00% | NA |
| Indica II | 465 | 75.90% | 23.40% | 0.65% | 0.00% | NA |
| Indica III | 913 | 83.10% | 16.50% | 0.33% | 0.00% | NA |
| Indica Intermediate | 786 | 74.30% | 25.40% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 98.30% | 1.70% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 71.60% | 28.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 90.50% | 9.50% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 66.70% | 33.30% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1117272721 | C -> T | LOC_Os11g29760.1 | downstream_gene_variant ; 3429.0bp to feature; MODIFIER | silent_mutation | Average:32.202; most accessible tissue: Callus, score: 60.472 | N | N | N | N |
| vg1117272721 | C -> T | LOC_Os11g29770.1 | downstream_gene_variant ; 612.0bp to feature; MODIFIER | silent_mutation | Average:32.202; most accessible tissue: Callus, score: 60.472 | N | N | N | N |
| vg1117272721 | C -> T | LOC_Os11g29760-LOC_Os11g29770 | intergenic_region ; MODIFIER | silent_mutation | Average:32.202; most accessible tissue: Callus, score: 60.472 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1117272721 | NA | 9.57E-16 | Grain_length | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg1117272721 | NA | 1.26E-14 | Grain_length | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg1117272721 | NA | 1.74E-09 | mr1157 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117272721 | NA | 1.29E-07 | mr1229 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117272721 | NA | 2.25E-07 | mr1328 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117272721 | NA | 6.35E-09 | mr1446 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117272721 | NA | 3.72E-15 | mr1539 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117272721 | NA | 4.03E-19 | mr1540 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117272721 | NA | 6.24E-21 | mr1732 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117272721 | NA | 3.65E-07 | mr1763 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117272721 | NA | 5.72E-06 | mr1871 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1117272721 | NA | 1.76E-06 | mr1582_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |