\
| Variant ID: vg1116465115 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 16465115 |
| Reference Allele: A | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
CTCTACAACACATGGTTTCTTAAAGTGGTCCATTAATAAATACATCATCTCTCTTCTGTACCAATCATATTTATTCTTCATATATTATGAAGACACTATT[A/C]
TTTACCAATGCAAAACTTGATAGTGTCTAGTGCATAGGTTCTCGTGTTGAAGCTGTCTCTTGCATGAGACCCAGTTTTTTCCTCTCTTCACTATCTCTCT
AGAGAGATAGTGAAGAGAGGAAAAAACTGGGTCTCATGCAAGAGACAGCTTCAACACGAGAACCTATGCACTAGACACTATCAAGTTTTGCATTGGTAAA[T/G]
AATAGTGTCTTCATAATATATGAAGAATAAATATGATTGGTACAGAAGAGAGATGATGTATTTATTAATGGACCACTTTAAGAAACCATGTGTTGTAGAG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 65.50% | 34.20% | 0.34% | 0.00% | NA |
| All Indica | 2759 | 98.40% | 1.20% | 0.33% | 0.00% | NA |
| All Japonica | 1512 | 4.40% | 95.40% | 0.26% | 0.00% | NA |
| Aus | 269 | 93.30% | 6.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 98.80% | 0.80% | 0.34% | 0.00% | NA |
| Indica II | 465 | 99.10% | 0.40% | 0.43% | 0.00% | NA |
| Indica III | 913 | 99.20% | 0.70% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 96.80% | 2.70% | 0.51% | 0.00% | NA |
| Temperate Japonica | 767 | 2.90% | 96.90% | 0.26% | 0.00% | NA |
| Tropical Japonica | 504 | 6.90% | 92.70% | 0.40% | 0.00% | NA |
| Japonica Intermediate | 241 | 3.70% | 96.30% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 10.40% | 88.50% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 57.80% | 40.00% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1116465115 | A -> C | LOC_Os11g28550.1 | downstream_gene_variant ; 3321.0bp to feature; MODIFIER | silent_mutation | Average:43.447; most accessible tissue: Zhenshan97 panicle, score: 65.386 | N | N | N | N |
| vg1116465115 | A -> C | LOC_Os11g28540-LOC_Os11g28550 | intergenic_region ; MODIFIER | silent_mutation | Average:43.447; most accessible tissue: Zhenshan97 panicle, score: 65.386 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1116465115 | NA | 5.35E-19 | Yield | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg1116465115 | NA | 1.73E-78 | mr1135 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116465115 | NA | 6.24E-24 | mr1375 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116465115 | NA | 3.18E-23 | mr1383 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116465115 | NA | 2.50E-87 | mr1504 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116465115 | NA | 7.68E-89 | mr1517 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116465115 | NA | 1.48E-88 | mr1672 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116465115 | NA | 1.39E-21 | mr1698 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116465115 | 3.62E-07 | 5.07E-103 | mr1758 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116465115 | 1.18E-06 | 1.18E-06 | mr1758 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116465115 | NA | 6.81E-07 | mr1797 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116465115 | NA | 6.81E-07 | mr1801 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116465115 | NA | 1.30E-40 | mr1873 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116465115 | NA | 2.29E-38 | mr1541_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116465115 | 5.59E-11 | 2.19E-147 | mr1758_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116465115 | 9.41E-09 | 5.28E-12 | mr1758_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |