\
| Variant ID: vg1116239941 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 16239941 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.70, T: 0.30, others allele: 0.00, population size: 86. )
GCACTTCTTCGACAGCCATCACAGCCTTGCCCGCCCGATCTGTTCTGAACTTTCTCCAAGTCATGGGGGCTTGGCCTTGCCTTGGCGGCTGTCCCTGGAT[T/C]
GCCGGCTGAGACTGGCGAACAGAGAGGGGAGGTGGTTCGGCAATTTGAACTTGTGCTTGAGCTTGAGCAGCGGCGACGGAGGCTTTATCGTACTCAGCTT
AAGCTGAGTACGATAAAGCCTCCGTCGCCGCTGCTCAAGCTCAAGCACAAGTTCAAATTGCCGAACCACCTCCCCTCTCTGTTCGCCAGTCTCAGCCGGC[A/G]
ATCCAGGGACAGCCGCCAAGGCAAGGCCAAGCCCCCATGACTTGGAGAAAGTTCAGAACAGATCGGGCGGGCAAGGCTGTGATGGCTGTCGAAGAAGTGC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 63.90% | 34.40% | 1.08% | 0.57% | NA |
| All Indica | 2759 | 98.10% | 1.40% | 0.54% | 0.00% | NA |
| All Japonica | 1512 | 3.40% | 96.60% | 0.00% | 0.00% | NA |
| Aus | 269 | 74.70% | 1.90% | 13.38% | 10.04% | NA |
| Indica I | 595 | 97.10% | 2.20% | 0.67% | 0.00% | NA |
| Indica II | 465 | 99.10% | 0.90% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 96.60% | 2.00% | 1.40% | 0.00% | NA |
| Temperate Japonica | 767 | 3.30% | 96.70% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 4.00% | 96.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 2.50% | 97.50% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 11.50% | 88.50% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 56.70% | 43.30% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1116239941 | T -> DEL | LOC_Os11g28250.1 | N | frameshift_variant | Average:23.774; most accessible tissue: Zhenshan97 flag leaf, score: 49.013 | N | N | N | N |
| vg1116239941 | T -> C | LOC_Os11g28250.1 | synonymous_variant ; p.Ala547Ala; LOW | synonymous_codon | Average:23.774; most accessible tissue: Zhenshan97 flag leaf, score: 49.013 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1116239941 | NA | 1.05E-18 | Yield | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg1116239941 | NA | 2.03E-75 | mr1135 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116239941 | NA | 3.72E-23 | mr1375 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116239941 | NA | 1.48E-22 | mr1383 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116239941 | NA | 2.20E-89 | mr1517 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116239941 | NA | 3.46E-68 | mr1538 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116239941 | NA | 1.77E-56 | mr1594 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116239941 | NA | 4.74E-86 | mr1672 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116239941 | 3.01E-15 | 1.19E-116 | mr1758 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116239941 | 8.61E-07 | 8.61E-07 | mr1758 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116239941 | NA | 6.39E-40 | mr1891 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116239941 | NA | 1.04E-15 | mr1162_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116239941 | 1.36E-11 | 1.51E-157 | mr1758_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1116239941 | NA | 4.52E-09 | mr1758_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |