\
| Variant ID: vg1114450021 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 14450021 |
| Reference Allele: G | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: G |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.83, G: 0.17, others allele: 0.00, population size: 58. )
ATGTTAATTGCCACATTAGGTCATTATACATTTAGACTTGTGCTCACTTTTCACACACACACACACTTCACTGGGTTTGGCCTGACCAGGGGCGGTCAGA[G/C]
CAGCCACATAGTGGCGGTCTGACCGGCGCCACAATGGCGGTCTGACCGGCGCATAAGGCCAGTCTGACCGGCAGGACATGCGCGGTCAGACCGGCCCCCT
AGGGGGCCGGTCTGACCGCGCATGTCCTGCCGGTCAGACTGGCCTTATGCGCCGGTCAGACCGCCATTGTGGCGCCGGTCAGACCGCCACTATGTGGCTG[C/G]
TCTGACCGCCCCTGGTCAGGCCAAACCCAGTGAAGTGTGTGTGTGTGTGAAAAGTGAGCACAAGTCTAAATGTATAATGACCTAATGTGGCAATTAACAT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 64.00% | 35.60% | 0.36% | 0.00% | NA |
| All Indica | 2759 | 96.20% | 3.50% | 0.33% | 0.00% | NA |
| All Japonica | 1512 | 3.10% | 96.70% | 0.20% | 0.00% | NA |
| Aus | 269 | 98.50% | 1.10% | 0.37% | 0.00% | NA |
| Indica I | 595 | 93.10% | 6.40% | 0.50% | 0.00% | NA |
| Indica II | 465 | 98.50% | 1.50% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 93.60% | 5.60% | 0.76% | 0.00% | NA |
| Temperate Japonica | 767 | 3.00% | 96.60% | 0.39% | 0.00% | NA |
| Tropical Japonica | 504 | 3.80% | 96.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 2.10% | 97.90% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 9.40% | 86.50% | 4.17% | 0.00% | NA |
| Intermediate | 90 | 56.70% | 43.30% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1114450021 | G -> C | LOC_Os11g25360.1 | downstream_gene_variant ; 3169.0bp to feature; MODIFIER | silent_mutation | Average:43.567; most accessible tissue: Minghui63 young leaf, score: 72.959 | N | N | N | N |
| vg1114450021 | G -> C | LOC_Os11g25350.1 | intron_variant ; MODIFIER | silent_mutation | Average:43.567; most accessible tissue: Minghui63 young leaf, score: 72.959 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1114450021 | NA | 1.32E-18 | Yield | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg1114450021 | NA | 2.67E-19 | mr1021 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114450021 | NA | 1.31E-74 | mr1135 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114450021 | NA | 3.65E-22 | mr1168 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114450021 | NA | 1.52E-09 | mr1336 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114450021 | NA | 2.50E-25 | mr1383 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114450021 | NA | 6.55E-13 | mr1701 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114450021 | 2.78E-07 | NA | mr1719 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114450021 | 3.03E-07 | 2.17E-106 | mr1758 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114450021 | NA | 4.06E-06 | mr1020_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114450021 | NA | 6.59E-20 | mr1168_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114450021 | NA | 1.35E-07 | mr1335_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114450021 | 7.51E-07 | 5.06E-151 | mr1758_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114450021 | NA | 3.68E-09 | mr1835_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1114450021 | NA | 1.04E-21 | mr1971_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |