\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1113344086:

Variant ID: vg1113344086 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 13344086
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, T: 0.00, others allele: 0.00, population size: 204. )

Flanking Sequence (100 bp) in Reference Genome:


AACCTTCCCACTACATAAAACTATACAAAATTATCAAACTACCCTCTTTCTCTTAATTCTGTCCACTTAACTAGATATAGATCTAAGTTCATAAAAACAA[T/C]
GATAGCATATAGATCTTCTACAATAAACCTATCAAAACATTGTGAAATCTATGGTACATTGATCATGTACAATATTTCATAAAAAGTTTTACCGTTTTGA

Reverse complement sequence

TCAAAACGGTAAAACTTTTTATGAAATATTGTACATGATCAATGTACCATAGATTTCACAATGTTTTGATAGGTTTATTGTAGAAGATCTATATGCTATC[A/G]
TTGTTTTTATGAACTTAGATCTATATCTAGTTAAGTGGACAGAATTAAGAGAAAGAGGGTAGTTTGATAATTTTGTATAGTTTTATGTAGTGGGAAGGTT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 54.40% 43.70% 1.90% 0.00% NA
All Indica  2759 79.00% 17.90% 3.04% 0.00% NA
All Japonica  1512 4.30% 95.50% 0.20% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 67.70% 24.90% 7.39% 0.00% NA
Indica II  465 98.70% 0.60% 0.65% 0.00% NA
Indica III  913 72.90% 25.40% 1.64% 0.00% NA
Indica Intermediate  786 83.00% 14.20% 2.80% 0.00% NA
Temperate Japonica  767 2.90% 97.00% 0.13% 0.00% NA
Tropical Japonica  504 7.90% 91.90% 0.20% 0.00% NA
Japonica Intermediate  241 1.20% 98.30% 0.41% 0.00% NA
VI/Aromatic  96 14.60% 85.40% 0.00% 0.00% NA
Intermediate  90 50.00% 46.70% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1113344086 T -> C LOC_Os11g23180.1 upstream_gene_variant ; 1881.0bp to feature; MODIFIER silent_mutation Average:36.8; most accessible tissue: Zhenshan97 young leaf, score: 58.398 N N N N
vg1113344086 T -> C LOC_Os11g23170.1 downstream_gene_variant ; 2439.0bp to feature; MODIFIER silent_mutation Average:36.8; most accessible tissue: Zhenshan97 young leaf, score: 58.398 N N N N
vg1113344086 T -> C LOC_Os11g23170.2 downstream_gene_variant ; 2417.0bp to feature; MODIFIER silent_mutation Average:36.8; most accessible tissue: Zhenshan97 young leaf, score: 58.398 N N N N
vg1113344086 T -> C LOC_Os11g23170.3 downstream_gene_variant ; 1944.0bp to feature; MODIFIER silent_mutation Average:36.8; most accessible tissue: Zhenshan97 young leaf, score: 58.398 N N N N
vg1113344086 T -> C LOC_Os11g23170-LOC_Os11g23180 intergenic_region ; MODIFIER silent_mutation Average:36.8; most accessible tissue: Zhenshan97 young leaf, score: 58.398 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1113344086 NA 3.52E-19 Yield All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1113344086 NA 1.13E-14 mr1062 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1113344086 NA 1.50E-11 mr1070 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1113344086 NA 8.99E-17 mr1116 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1113344086 NA 1.19E-11 mr1128 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1113344086 NA 4.52E-08 mr1190 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1113344086 NA 6.26E-09 mr1198 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1113344086 NA 2.66E-11 mr1336 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1113344086 NA 7.14E-13 mr1386 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1113344086 NA 9.00E-07 mr1392 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1113344086 NA 9.58E-06 mr1418 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1113344086 NA 1.44E-06 mr1420 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1113344086 NA 3.84E-07 mr1445 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1113344086 NA 3.20E-08 mr1488 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1113344086 NA 2.80E-12 mr1636 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1113344086 NA 3.32E-15 mr1641 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1113344086 NA 2.68E-07 mr1659 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1113344086 NA 3.43E-13 mr1683 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1113344086 NA 2.17E-07 mr1739 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1113344086 NA 2.48E-11 mr1751 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1113344086 NA 3.80E-23 mr1767 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1113344086 NA 2.76E-08 mr1776 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1113344086 NA 3.24E-07 mr1779 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1113344086 NA 4.65E-22 mr1838 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1113344086 NA 9.69E-30 mr1839 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1113344086 NA 2.56E-08 mr1839 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1113344086 NA 2.08E-18 mr1909 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1113344086 NA 1.03E-12 mr1921 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1113344086 NA 1.36E-13 mr1128_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1113344086 NA 3.84E-15 mr1767_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251