\
| Variant ID: vg1111472931 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 11472931 |
| Reference Allele: G | Alternative Allele: C,T |
| Primary Allele: C | Secondary Allele: G |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, G: 0.01, others allele: 0.00, population size: 117. )
TTACCATTATGGTCGCGATAATATTTTATTTATTTCTATCCTCACCTAATCTTTATTTTAAATTATATTTATTTTGCCAATTTATTTTTAGGGTTTATTC[G/C,T]
TAATTAACTATTCTTTACTCACGACTAATGAATTTCGAAATCAAATCCAAATAAAATAGGCGAATAGAATCGGCATGATGTAGTTAATTTAAAAAGTTTT
AAAACTTTTTAAATTAACTACATCATGCCGATTCTATTCGCCTATTTTATTTGGATTTGATTTCGAAATTCATTAGTCGTGAGTAAAGAATAGTTAATTA[C/G,A]
GAATAAACCCTAAAAATAAATTGGCAAAATAAATATAATTTAAAATAAAGATTAGGTGAGGATAGAAATAAATAAAATATTATCGCGACCATAATGGTAA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 65.90% | 33.60% | 0.47% | 0.00% | T: 0.06% |
| All Indica | 2759 | 97.70% | 1.60% | 0.62% | 0.00% | T: 0.04% |
| All Japonica | 1512 | 5.20% | 94.60% | 0.20% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 95.30% | 3.00% | 1.68% | 0.00% | NA |
| Indica II | 465 | 98.90% | 0.40% | 0.65% | 0.00% | NA |
| Indica III | 913 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 96.60% | 2.80% | 0.51% | 0.00% | T: 0.13% |
| Temperate Japonica | 767 | 3.80% | 96.10% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 8.50% | 91.10% | 0.40% | 0.00% | NA |
| Japonica Intermediate | 241 | 2.90% | 97.10% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 16.70% | 83.30% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 58.90% | 36.70% | 2.22% | 0.00% | T: 2.22% |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1111472931 | G -> T | LOC_Os11g19920.1 | upstream_gene_variant ; 4039.0bp to feature; MODIFIER | silent_mutation | Average:27.007; most accessible tissue: Callus, score: 32.917 | N | N | N | N |
| vg1111472931 | G -> T | LOC_Os11g19940.1 | downstream_gene_variant ; 1961.0bp to feature; MODIFIER | silent_mutation | Average:27.007; most accessible tissue: Callus, score: 32.917 | N | N | N | N |
| vg1111472931 | G -> T | LOC_Os11g19950.1 | downstream_gene_variant ; 4854.0bp to feature; MODIFIER | silent_mutation | Average:27.007; most accessible tissue: Callus, score: 32.917 | N | N | N | N |
| vg1111472931 | G -> T | LOC_Os11g19930.1 | intron_variant ; MODIFIER | silent_mutation | Average:27.007; most accessible tissue: Callus, score: 32.917 | N | N | N | N |
| vg1111472931 | G -> C | LOC_Os11g19920.1 | upstream_gene_variant ; 4039.0bp to feature; MODIFIER | silent_mutation | Average:27.007; most accessible tissue: Callus, score: 32.917 | N | N | N | N |
| vg1111472931 | G -> C | LOC_Os11g19940.1 | downstream_gene_variant ; 1961.0bp to feature; MODIFIER | silent_mutation | Average:27.007; most accessible tissue: Callus, score: 32.917 | N | N | N | N |
| vg1111472931 | G -> C | LOC_Os11g19950.1 | downstream_gene_variant ; 4854.0bp to feature; MODIFIER | silent_mutation | Average:27.007; most accessible tissue: Callus, score: 32.917 | N | N | N | N |
| vg1111472931 | G -> C | LOC_Os11g19930.1 | intron_variant ; MODIFIER | silent_mutation | Average:27.007; most accessible tissue: Callus, score: 32.917 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1111472931 | NA | 9.47E-19 | Yield | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg1111472931 | NA | 2.74E-102 | mr1008 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1111472931 | NA | 1.09E-100 | mr1009 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1111472931 | NA | 3.48E-19 | mr1021 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1111472931 | NA | 8.24E-68 | mr1027 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1111472931 | NA | 9.64E-11 | mr1084 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1111472931 | NA | 4.31E-10 | mr1097 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1111472931 | NA | 3.31E-20 | mr1102 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1111472931 | NA | 6.42E-24 | mr1122 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1111472931 | NA | 4.71E-84 | mr1134 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1111472931 | NA | 4.57E-85 | mr1135 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1111472931 | NA | 3.96E-45 | mr1152 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1111472931 | NA | 1.92E-50 | mr1154 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1111472931 | NA | 2.38E-22 | mr1168 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1111472931 | NA | 1.48E-09 | mr1198 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1111472931 | NA | 1.37E-27 | mr1223 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1111472931 | NA | 5.17E-10 | mr1307 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1111472931 | NA | 6.08E-25 | mr1375 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1111472931 | NA | 4.57E-15 | mr1376 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1111472931 | NA | 7.52E-25 | mr1383 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1111472931 | NA | 4.57E-15 | mr1431 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1111472931 | NA | 3.04E-08 | mr1488 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1111472931 | NA | 6.30E-94 | mr1504 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1111472931 | NA | 1.36E-88 | mr1517 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1111472931 | NA | 4.72E-69 | mr1538 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1111472931 | NA | 7.00E-37 | mr1542 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1111472931 | NA | 9.90E-12 | mr1636 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1111472931 | NA | 1.47E-13 | mr1641 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1111472931 | NA | 9.93E-39 | mr1645 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1111472931 | NA | 1.23E-31 | mr1647 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1111472931 | NA | 4.73E-37 | mr1670 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1111472931 | NA | 1.10E-88 | mr1672 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1111472931 | NA | 4.19E-35 | mr1682 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1111472931 | NA | 9.79E-22 | mr1698 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1111472931 | NA | 2.51E-13 | mr1701 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1111472931 | NA | 3.19E-28 | mr1723 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1111472931 | NA | 1.14E-113 | mr1750 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1111472931 | 5.18E-14 | 5.55E-116 | mr1758 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1111472931 | NA | 5.16E-18 | mr1767 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1111472931 | NA | 1.94E-11 | mr1775 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1111472931 | NA | 4.01E-07 | mr1797 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1111472931 | NA | 4.01E-07 | mr1801 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1111472931 | NA | 5.52E-20 | mr1838 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1111472931 | NA | 8.41E-22 | mr1839 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1111472931 | NA | 2.64E-39 | mr1873 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1111472931 | NA | 9.13E-38 | mr1882 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1111472931 | NA | 2.21E-53 | mr1889 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1111472931 | NA | 1.64E-13 | mr1909 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1111472931 | NA | 9.66E-29 | mr1922 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1111472931 | NA | 5.55E-09 | mr1986 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1111472931 | NA | 4.68E-103 | mr1987 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1111472931 | NA | 2.47E-43 | mr1542_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1111472931 | NA | 2.69E-149 | mr1758_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |