Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1111009061:

Variant ID: vg1111009061 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 11009061
Reference Allele: AAlternative Allele: T
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.63, A: 0.37, others allele: 0.00, population size: 93. )

Flanking Sequence (100 bp) in Reference Genome:


AAAACGGATCTAAATCGGAATAGGACGGTTTGTTAAAATGAAAGGACAACGGACGAAAATACGATGAGTATAAAATCATCTTTAATTTATATAACTAGGA[A/T]
GGAAGCCCGCGCACATGTGCGGGCAATTTATTTATTGTCTATAAAAAGAATATTAAAAGAAGCCCTATCTCACTATATTCACTATAAGAAATAGATAATA

Reverse complement sequence

TATTATCTATTTCTTATAGTGAATATAGTGAGATAGGGCTTCTTTTAATATTCTTTTTATAGACAATAAATAAATTGCCCGCACATGTGCGCGGGCTTCC[T/A]
TCCTAGTTATATAAATTAAAGATGATTTTATACTCATCGTATTTTCGTCCGTTGTCCTTTCATTTTAACAAACCGTCCTATTCCGATTTAGATCCGTTTT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 50.90% 49.00% 0.08% 0.00% NA
All Indica  2759 29.10% 70.80% 0.11% 0.00% NA
All Japonica  1512 97.00% 3.00% 0.00% 0.00% NA
Aus  269 0.70% 99.30% 0.00% 0.00% NA
Indica I  595 40.80% 59.00% 0.17% 0.00% NA
Indica II  465 5.40% 94.60% 0.00% 0.00% NA
Indica III  913 34.40% 65.60% 0.00% 0.00% NA
Indica Intermediate  786 28.20% 71.50% 0.25% 0.00% NA
Temperate Japonica  767 99.20% 0.80% 0.00% 0.00% NA
Tropical Japonica  504 92.70% 7.30% 0.00% 0.00% NA
Japonica Intermediate  241 99.20% 0.80% 0.00% 0.00% NA
VI/Aromatic  96 87.50% 12.50% 0.00% 0.00% NA
Intermediate  90 55.60% 43.30% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1111009061 A -> T LOC_Os11g19250.1 upstream_gene_variant ; 3946.0bp to feature; MODIFIER silent_mutation Average:29.662; most accessible tissue: Zhenshan97 panicle, score: 39.652 N N N N
vg1111009061 A -> T LOC_Os11g19240-LOC_Os11g19250 intergenic_region ; MODIFIER silent_mutation Average:29.662; most accessible tissue: Zhenshan97 panicle, score: 39.652 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1111009061 NA 7.39E-19 Yield All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1111009061 NA 4.87E-11 mr1070 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1111009061 NA 6.65E-12 mr1128 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1111009061 NA 2.40E-07 mr1190 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1111009061 NA 3.39E-10 mr1336 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1111009061 NA 2.35E-06 mr1392 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1111009061 NA 2.16E-06 mr1445 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1111009061 NA 9.18E-06 mr1633 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1111009061 NA 2.25E-12 mr1636 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1111009061 NA 2.13E-13 mr1641 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1111009061 NA 1.06E-07 mr1659 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1111009061 NA 1.90E-11 mr1683 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1111009061 NA 4.94E-09 mr1739 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1111009061 NA 5.47E-21 mr1767 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1111009061 NA 1.26E-26 mr1839 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1111009061 NA 4.37E-06 mr1839 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1111009061 NA 4.45E-19 mr1909 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1111009061 NA 3.20E-13 mr1921 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1111009061 NA 3.54E-14 mr1128_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1111009061 NA 7.17E-21 mr1627_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1111009061 NA 4.48E-09 mr1739_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251