\
| Variant ID: vg1109529985 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 9529985 |
| Reference Allele: G | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 76. )
CTTCAGGGACAACAAGGACAGGATCCGAGTTCTCTATCTGAAGATAGAACCATCTTTCCCGCCATTTGCTGCGAGAAGAGGGGCACTGGAAAGGGATGTA[G/T]
CGCAACTTCAGGCGATCCCGAAGTCGAAATCCAACACATCCGGACACCCTATTGGGTTCCATCTAGCGCAACTCATAGTAAAATCGGAAAAGATCAAGGA
TCCTTGATCTTTTCCGATTTTACTATGAGTTGCGCTAGATGGAACCCAATAGGGTGTCCGGATGTGTTGGATTTCGACTTCGGGATCGCCTGAAGTTGCG[C/A]
TACATCCCTTTCCAGTGCCCCTCTTCTCGCAGCAAATGGCGGGAAAGATGGTTCTATCTTCAGATAGAGAACTCGGATCCTGTCCTTGTTGTCCCTGAAG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 56.60% | 34.70% | 1.74% | 6.96% | NA |
| All Indica | 2759 | 87.40% | 4.50% | 2.14% | 5.98% | NA |
| All Japonica | 1512 | 2.10% | 95.90% | 0.13% | 1.85% | NA |
| Aus | 269 | 66.50% | 3.30% | 5.58% | 24.54% | NA |
| Indica I | 595 | 80.80% | 7.70% | 3.19% | 8.24% | NA |
| Indica II | 465 | 87.30% | 4.10% | 2.58% | 6.02% | NA |
| Indica III | 913 | 92.60% | 1.20% | 1.75% | 4.49% | NA |
| Indica Intermediate | 786 | 86.30% | 6.20% | 1.53% | 5.98% | NA |
| Temperate Japonica | 767 | 1.00% | 97.10% | 0.13% | 1.69% | NA |
| Tropical Japonica | 504 | 3.60% | 94.40% | 0.20% | 1.79% | NA |
| Japonica Intermediate | 241 | 2.50% | 95.00% | 0.00% | 2.49% | NA |
| VI/Aromatic | 96 | 16.70% | 19.80% | 2.08% | 61.46% | NA |
| Intermediate | 90 | 42.20% | 41.10% | 4.44% | 12.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1109529985 | G -> T | LOC_Os11g17160.1 | synonymous_variant ; p.Arg65Arg; LOW | synonymous_codon | Average:21.776; most accessible tissue: Callus, score: 39.317 | N | N | N | N |
| vg1109529985 | G -> DEL | LOC_Os11g17160.1 | N | frameshift_variant | Average:21.776; most accessible tissue: Callus, score: 39.317 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1109529985 | NA | 5.35E-19 | Yield | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg1109529985 | NA | 3.11E-07 | mr1220 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1109529985 | NA | 1.41E-08 | mr1986 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1109529985 | NA | 5.84E-06 | mr1220_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1109529985 | 1.49E-06 | 1.49E-06 | mr1405_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1109529985 | NA | 5.42E-13 | mr1521_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1109529985 | 8.08E-06 | 1.97E-06 | mr1554_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1109529985 | 2.64E-07 | NA | mr1558_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1109529985 | NA | 1.27E-10 | mr1646_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1109529985 | 3.36E-06 | 2.47E-06 | mr1646_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1109529985 | NA | 1.05E-08 | mr1751_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1109529985 | NA | 5.14E-11 | mr1781_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1109529985 | NA | 5.71E-09 | mr1835_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |