\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1109175716:

Variant ID: vg1109175716 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 9175716
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.02, others allele: 0.00, population size: 120. )

Flanking Sequence (100 bp) in Reference Genome:


TTGTCCGATATTGAAAGTTCAGGATGAGCAATGTCTGGTTTTCGGGTTCAGGGGGTAATTCGGTCGACCGCGATAGTTCAGGGGGTAGTTTGTATTTTTT[C/T]
CTTTTATTTTTATATGAATGTAAGTATAGTAAGACTAAAAGAAATTTTCTTTCCTATAAGTCGTAGAAGTGTGCATGCATAACTATTTCTCTATTTTTCA

Reverse complement sequence

TGAAAAATAGAGAAATAGTTATGCATGCACACTTCTACGACTTATAGGAAAGAAAATTTCTTTTAGTCTTACTATACTTACATTCATATAAAAATAAAAG[G/A]
AAAAAATACAAACTACCCCCTGAACTATCGCGGTCGACCGAATTACCCCCTGAACCCGAAAACCAGACATTGCTCATCCTGAACTTTCAATATCGGACAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 85.90% 14.00% 0.11% 0.00% NA
All Indica  2759 76.60% 23.20% 0.18% 0.00% NA
All Japonica  1512 99.90% 0.10% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 43.40% 56.30% 0.22% 0.00% NA
Indica III  913 74.90% 24.80% 0.33% 0.00% NA
Indica Intermediate  786 80.40% 19.50% 0.13% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.60% 0.40% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 81.10% 18.90% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1109175716 C -> T LOC_Os11g16540.1 upstream_gene_variant ; 2378.0bp to feature; MODIFIER silent_mutation Average:78.348; most accessible tissue: Callus, score: 92.719 N N N N
vg1109175716 C -> T LOC_Os11g16550.1 upstream_gene_variant ; 1290.0bp to feature; MODIFIER silent_mutation Average:78.348; most accessible tissue: Callus, score: 92.719 N N N N
vg1109175716 C -> T LOC_Os11g16560.1 downstream_gene_variant ; 3119.0bp to feature; MODIFIER silent_mutation Average:78.348; most accessible tissue: Callus, score: 92.719 N N N N
vg1109175716 C -> T LOC_Os11g16540-LOC_Os11g16550 intergenic_region ; MODIFIER silent_mutation Average:78.348; most accessible tissue: Callus, score: 92.719 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1109175716 NA 1.57E-13 Grain_length All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1109175716 NA 5.46E-06 mr1077 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109175716 NA 3.64E-06 mr1149 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109175716 NA 4.56E-13 mr1183 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109175716 NA 2.21E-08 mr1277 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109175716 NA 1.24E-09 mr1352 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109175716 NA 2.31E-06 mr1352 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109175716 NA 5.13E-07 mr1715 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109175716 NA 3.35E-09 mr1794 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109175716 NA 7.81E-09 mr1829 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109175716 NA 3.81E-07 mr1837 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109175716 NA 1.90E-07 mr1902 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109175716 NA 2.00E-09 mr1829_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1109175716 NA 2.00E-06 mr1842_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251