Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1104369663:

Variant ID: vg1104369663 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 4369663
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 72. )

Flanking Sequence (100 bp) in Reference Genome:

GGATTTTTAAAATGAGGGAGTAGAATATAAGGGCATTCCCAACCCAATGACTAGGATGGTGTCCATAGCATTAAATAAGTTGCTACTTAGGACAAAAAAT[G/A]
ATGTAGCAAGTAAATAAATGAGGAAAGAGAAGAAAACCATGTCTTGCATGAGACATGGTTTCTACACAACATCCAAGACATCATGTGAGATAAGTAGCAT

Reverse complement sequence

ATGCTACTTATCTCACATGATGTCTTGGATGTTGTGTAGAAACCATGTCTCATGCAAGACATGGTTTTCTTCTCTTTCCTCATTTATTTACTTGCTACAT[C/T]
ATTTTTTGTCCTAAGTAGCAACTTATTTAATGCTATGGACACCATCCTAGTCATTGGGTTGGGAATGCCCTTATATTCTACTCCCTCATTTTAAAAATCC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	65.00%	25.30%	7.15%	2.58%	NA
All Indica	2759	51.20%	35.40%	9.42%	3.99%	NA
All Japonica	1512	88.20%	8.90%	2.45%	0.40%	NA
Aus	269	71.70%	15.60%	12.27%	0.37%	NA
Indica I	595	94.50%	4.50%	0.84%	0.17%	NA
Indica II	465	20.60%	55.90%	14.84%	8.60%	NA
Indica III	913	45.30%	40.00%	11.06%	3.61%	NA
Indica Intermediate	786	43.30%	41.30%	10.81%	4.58%	NA
Temperate Japonica	767	97.50%	1.70%	0.78%	0.00%	NA
Tropical Japonica	504	74.00%	20.00%	4.96%	0.99%	NA
Japonica Intermediate	241	88.40%	8.70%	2.49%	0.41%	NA
VI/Aromatic	96	79.20%	17.70%	3.12%	0.00%	NA
Intermediate	90	63.30%	25.60%	5.56%	5.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1104369663	G -> A	LOC_Os11g08290.1	downstream_gene_variant ; 3989.0bp to feature; MODIFIER	silent_mutation	Average:45.68; most accessible tissue: Minghui63 panicle, score: 76.913	N	N	N	N
vg1104369663	G -> A	LOC_Os11g08285-LOC_Os11g08290	intergenic_region ; MODIFIER	silent_mutation	Average:45.68; most accessible tissue: Minghui63 panicle, score: 76.913	N	N	N	N
vg1104369663	G -> DEL	N	N	silent_mutation	Average:45.68; most accessible tissue: Minghui63 panicle, score: 76.913	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1104369663	NA	1.70E-13	Grain_length	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1104369663	NA	5.35E-06	mr1074	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104369663	NA	6.10E-06	mr1124	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104369663	NA	6.22E-06	mr1231	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104369663	NA	8.05E-07	mr1441	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104369663	NA	1.22E-06	mr1598	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104369663	NA	2.88E-07	mr1962	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104369663	NA	3.97E-07	mr1174_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104369663	NA	1.89E-06	mr1293_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104369663	NA	5.05E-09	mr1347_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104369663	NA	3.08E-09	mr1347_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104369663	NA	3.36E-07	mr1497_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104369663	NA	9.52E-07	mr1508_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104369663	NA	6.27E-09	mr1598_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104369663	NA	1.35E-08	mr1861_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251