\
| Variant ID: vg1104324598 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 4324598 |
| Reference Allele: G | Alternative Allele: A,T |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.94, A: 0.06, others allele: 0.00, population size: 73. )
AGATCCATTTCACATCGGAGTAGGACGGCAGGAAGGGCGCTCCCACCTCGGCGCCGGTGGGGGAGGCTGCGATCTGCGGTGGGATGACATGATTTGCGAT[G/A,T]
AGAGAAGGCGCACGGCGGCAGCTATAGGTAGGTGGTGGGAGGCATAGCTGCGTCCGTAGCGTGTGCTATAGCAGCGACAGGAGCGTGCGAGGGGGCGTTG
CAACGCCCCCTCGCACGCTCCTGTCGCTGCTATAGCACACGCTACGGACGCAGCTATGCCTCCCACCACCTACCTATAGCTGCCGCCGTGCGCCTTCTCT[C/T,A]
ATCGCAAATCATGTCATCCCACCGCAGATCGCAGCCTCCCCCACCGGCGCCGAGGTGGGAGCGCCCTTCCTGCCGTCCTACTCCGATGTGAAATGGATCT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 59.20% | 38.20% | 0.61% | 2.03% | T: 0.02% |
| All Indica | 2759 | 43.80% | 52.30% | 0.83% | 3.04% | NA |
| All Japonica | 1512 | 87.80% | 11.30% | 0.26% | 0.53% | T: 0.07% |
| Aus | 269 | 75.80% | 24.20% | 0.00% | 0.00% | NA |
| Indica I | 595 | 92.40% | 6.60% | 0.50% | 0.50% | NA |
| Indica II | 465 | 12.70% | 85.80% | 0.65% | 0.86% | NA |
| Indica III | 913 | 35.40% | 57.80% | 0.99% | 5.81% | NA |
| Indica Intermediate | 786 | 35.20% | 60.70% | 1.02% | 3.05% | NA |
| Temperate Japonica | 767 | 98.70% | 0.90% | 0.13% | 0.26% | NA |
| Tropical Japonica | 504 | 69.20% | 29.00% | 0.60% | 0.99% | T: 0.20% |
| Japonica Intermediate | 241 | 92.10% | 7.50% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 10.40% | 87.50% | 2.08% | 0.00% | NA |
| Intermediate | 90 | 51.10% | 44.40% | 0.00% | 4.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1104324598 | G -> T | LOC_Os11g08225.1 | upstream_gene_variant ; 2238.0bp to feature; MODIFIER | silent_mutation | Average:71.723; most accessible tissue: Zhenshan97 panicle, score: 91.03 | N | N | N | N |
| vg1104324598 | G -> T | LOC_Os11g08235.1 | upstream_gene_variant ; 543.0bp to feature; MODIFIER | silent_mutation | Average:71.723; most accessible tissue: Zhenshan97 panicle, score: 91.03 | N | N | N | N |
| vg1104324598 | G -> T | LOC_Os11g08240.1 | upstream_gene_variant ; 1440.0bp to feature; MODIFIER | silent_mutation | Average:71.723; most accessible tissue: Zhenshan97 panicle, score: 91.03 | N | N | N | N |
| vg1104324598 | G -> T | LOC_Os11g08250.1 | upstream_gene_variant ; 3171.0bp to feature; MODIFIER | silent_mutation | Average:71.723; most accessible tissue: Zhenshan97 panicle, score: 91.03 | N | N | N | N |
| vg1104324598 | G -> T | LOC_Os11g08230.1 | intron_variant ; MODIFIER | silent_mutation | Average:71.723; most accessible tissue: Zhenshan97 panicle, score: 91.03 | N | N | N | N |
| vg1104324598 | G -> A | LOC_Os11g08225.1 | upstream_gene_variant ; 2238.0bp to feature; MODIFIER | silent_mutation | Average:71.723; most accessible tissue: Zhenshan97 panicle, score: 91.03 | N | N | N | N |
| vg1104324598 | G -> A | LOC_Os11g08235.1 | upstream_gene_variant ; 543.0bp to feature; MODIFIER | silent_mutation | Average:71.723; most accessible tissue: Zhenshan97 panicle, score: 91.03 | N | N | N | N |
| vg1104324598 | G -> A | LOC_Os11g08240.1 | upstream_gene_variant ; 1440.0bp to feature; MODIFIER | silent_mutation | Average:71.723; most accessible tissue: Zhenshan97 panicle, score: 91.03 | N | N | N | N |
| vg1104324598 | G -> A | LOC_Os11g08250.1 | upstream_gene_variant ; 3171.0bp to feature; MODIFIER | silent_mutation | Average:71.723; most accessible tissue: Zhenshan97 panicle, score: 91.03 | N | N | N | N |
| vg1104324598 | G -> A | LOC_Os11g08230.1 | intron_variant ; MODIFIER | silent_mutation | Average:71.723; most accessible tissue: Zhenshan97 panicle, score: 91.03 | N | N | N | N |
| vg1104324598 | G -> DEL | N | N | silent_mutation | Average:71.723; most accessible tissue: Zhenshan97 panicle, score: 91.03 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1104324598 | NA | 2.31E-14 | Grain_length | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg1104324598 | NA | 1.10E-13 | Grain_length | Ind_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg1104324598 | NA | 1.73E-08 | mr1174 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104324598 | NA | 7.24E-07 | mr1174 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104324598 | 2.12E-08 | 1.24E-10 | mr1218 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104324598 | NA | 6.11E-06 | mr1347 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104324598 | NA | 5.94E-07 | mr1347 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104324598 | NA | 1.91E-06 | mr1441 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104324598 | NA | 4.78E-08 | mr1583 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104324598 | NA | 6.94E-06 | mr1622 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104324598 | 2.18E-10 | NA | mr1638 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104324598 | 2.48E-06 | 1.13E-08 | mr1638 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104324598 | 3.70E-06 | 7.63E-06 | mr1901 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104324598 | NA | 1.43E-06 | mr1169_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104324598 | NA | 4.50E-09 | mr1174_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104324598 | NA | 2.97E-09 | mr1174_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104324598 | NA | 2.92E-07 | mr1218_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104324598 | NA | 4.12E-08 | mr1347_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104324598 | NA | 7.70E-11 | mr1347_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1104324598 | NA | 9.76E-08 | mr1850_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |