\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1104324598:

Variant ID: vg1104324598 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 4324598
Reference Allele: GAlternative Allele: A,T
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.94, A: 0.06, others allele: 0.00, population size: 73. )

Flanking Sequence (100 bp) in Reference Genome:


AGATCCATTTCACATCGGAGTAGGACGGCAGGAAGGGCGCTCCCACCTCGGCGCCGGTGGGGGAGGCTGCGATCTGCGGTGGGATGACATGATTTGCGAT[G/A,T]
AGAGAAGGCGCACGGCGGCAGCTATAGGTAGGTGGTGGGAGGCATAGCTGCGTCCGTAGCGTGTGCTATAGCAGCGACAGGAGCGTGCGAGGGGGCGTTG

Reverse complement sequence

CAACGCCCCCTCGCACGCTCCTGTCGCTGCTATAGCACACGCTACGGACGCAGCTATGCCTCCCACCACCTACCTATAGCTGCCGCCGTGCGCCTTCTCT[C/T,A]
ATCGCAAATCATGTCATCCCACCGCAGATCGCAGCCTCCCCCACCGGCGCCGAGGTGGGAGCGCCCTTCCTGCCGTCCTACTCCGATGTGAAATGGATCT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.20% 38.20% 0.61% 2.03% T: 0.02%
All Indica  2759 43.80% 52.30% 0.83% 3.04% NA
All Japonica  1512 87.80% 11.30% 0.26% 0.53% T: 0.07%
Aus  269 75.80% 24.20% 0.00% 0.00% NA
Indica I  595 92.40% 6.60% 0.50% 0.50% NA
Indica II  465 12.70% 85.80% 0.65% 0.86% NA
Indica III  913 35.40% 57.80% 0.99% 5.81% NA
Indica Intermediate  786 35.20% 60.70% 1.02% 3.05% NA
Temperate Japonica  767 98.70% 0.90% 0.13% 0.26% NA
Tropical Japonica  504 69.20% 29.00% 0.60% 0.99% T: 0.20%
Japonica Intermediate  241 92.10% 7.50% 0.00% 0.41% NA
VI/Aromatic  96 10.40% 87.50% 2.08% 0.00% NA
Intermediate  90 51.10% 44.40% 0.00% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1104324598 G -> T LOC_Os11g08225.1 upstream_gene_variant ; 2238.0bp to feature; MODIFIER silent_mutation Average:71.723; most accessible tissue: Zhenshan97 panicle, score: 91.03 N N N N
vg1104324598 G -> T LOC_Os11g08235.1 upstream_gene_variant ; 543.0bp to feature; MODIFIER silent_mutation Average:71.723; most accessible tissue: Zhenshan97 panicle, score: 91.03 N N N N
vg1104324598 G -> T LOC_Os11g08240.1 upstream_gene_variant ; 1440.0bp to feature; MODIFIER silent_mutation Average:71.723; most accessible tissue: Zhenshan97 panicle, score: 91.03 N N N N
vg1104324598 G -> T LOC_Os11g08250.1 upstream_gene_variant ; 3171.0bp to feature; MODIFIER silent_mutation Average:71.723; most accessible tissue: Zhenshan97 panicle, score: 91.03 N N N N
vg1104324598 G -> T LOC_Os11g08230.1 intron_variant ; MODIFIER silent_mutation Average:71.723; most accessible tissue: Zhenshan97 panicle, score: 91.03 N N N N
vg1104324598 G -> A LOC_Os11g08225.1 upstream_gene_variant ; 2238.0bp to feature; MODIFIER silent_mutation Average:71.723; most accessible tissue: Zhenshan97 panicle, score: 91.03 N N N N
vg1104324598 G -> A LOC_Os11g08235.1 upstream_gene_variant ; 543.0bp to feature; MODIFIER silent_mutation Average:71.723; most accessible tissue: Zhenshan97 panicle, score: 91.03 N N N N
vg1104324598 G -> A LOC_Os11g08240.1 upstream_gene_variant ; 1440.0bp to feature; MODIFIER silent_mutation Average:71.723; most accessible tissue: Zhenshan97 panicle, score: 91.03 N N N N
vg1104324598 G -> A LOC_Os11g08250.1 upstream_gene_variant ; 3171.0bp to feature; MODIFIER silent_mutation Average:71.723; most accessible tissue: Zhenshan97 panicle, score: 91.03 N N N N
vg1104324598 G -> A LOC_Os11g08230.1 intron_variant ; MODIFIER silent_mutation Average:71.723; most accessible tissue: Zhenshan97 panicle, score: 91.03 N N N N
vg1104324598 G -> DEL N N silent_mutation Average:71.723; most accessible tissue: Zhenshan97 panicle, score: 91.03 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1104324598 NA 2.31E-14 Grain_length All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1104324598 NA 1.10E-13 Grain_length Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1104324598 NA 1.73E-08 mr1174 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104324598 NA 7.24E-07 mr1174 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104324598 2.12E-08 1.24E-10 mr1218 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104324598 NA 6.11E-06 mr1347 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104324598 NA 5.94E-07 mr1347 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104324598 NA 1.91E-06 mr1441 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104324598 NA 4.78E-08 mr1583 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104324598 NA 6.94E-06 mr1622 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104324598 2.18E-10 NA mr1638 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104324598 2.48E-06 1.13E-08 mr1638 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104324598 3.70E-06 7.63E-06 mr1901 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104324598 NA 1.43E-06 mr1169_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104324598 NA 4.50E-09 mr1174_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104324598 NA 2.97E-09 mr1174_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104324598 NA 2.92E-07 mr1218_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104324598 NA 4.12E-08 mr1347_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104324598 NA 7.70E-11 mr1347_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104324598 NA 9.76E-08 mr1850_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251