Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1104292362:

Variant ID: vg1104292362 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 4292362
Reference Allele: T	Alternative Allele: A
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TCCACATGACTCTTCAGGTGAGCAGCAAGGAGAACCTGCGGCCACATTCATTCATCTATGCTCTTCTTCGCTCAACTAAACCCTAACCCTTTTTCCCCAA[T/A]
TCCTCCTTTCAGATGGCTCGCAAGAGGCACCCACCCAGGCACCCAGCGCTGAGGAGGTCGTCGGAGCCGCAGCCCGGCGGGAAGCATCTCAGGCGACGGG

Reverse complement sequence

CCCGTCGCCTGAGATGCTTCCCGCCGGGCTGCGGCTCCGACGACCTCCTCAGCGCTGGGTGCCTGGGTGGGTGCCTCTTGCGAGCCATCTGAAAGGAGGA[A/T]
TTGGGGAAAAAGGGTTAGGGTTTAGTTGAGCGAAGAAGAGCATAGATGAATGAATGTGGCCGCAGGTTCTCCTTGCTGCTCACCTGAAGAGTCATGTGGA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	62.30%	36.90%	0.68%	0.11%	NA
All Indica	2759	48.70%	50.40%	0.80%	0.04%	NA
All Japonica	1512	88.30%	11.20%	0.40%	0.13%	NA
Aus	269	75.80%	23.80%	0.37%	0.00%	NA
Indica I	595	93.10%	6.40%	0.50%	0.00%	NA
Indica II	465	13.10%	85.80%	1.08%	0.00%	NA
Indica III	913	43.40%	56.20%	0.44%	0.00%	NA
Indica Intermediate	786	42.50%	56.10%	1.27%	0.13%	NA
Temperate Japonica	767	99.20%	0.80%	0.00%	0.00%	NA
Tropical Japonica	504	69.80%	28.80%	1.19%	0.20%	NA
Japonica Intermediate	241	92.10%	7.50%	0.00%	0.41%	NA
VI/Aromatic	96	12.50%	85.40%	2.08%	0.00%	NA
Intermediate	90	54.40%	42.20%	1.11%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1104292362	T -> A	LOC_Os11g08200.1	upstream_gene_variant ; 2796.0bp to feature; MODIFIER	silent_mutation	Average:93.497; most accessible tissue: Zhenshan97 flag leaf, score: 97.498	N	N	N	N
vg1104292362	T -> A	LOC_Os11g08180.1	downstream_gene_variant ; 4009.0bp to feature; MODIFIER	silent_mutation	Average:93.497; most accessible tissue: Zhenshan97 flag leaf, score: 97.498	N	N	N	N
vg1104292362	T -> A	LOC_Os11g08190.1	downstream_gene_variant ; 1101.0bp to feature; MODIFIER	silent_mutation	Average:93.497; most accessible tissue: Zhenshan97 flag leaf, score: 97.498	N	N	N	N
vg1104292362	T -> A	LOC_Os11g08190-LOC_Os11g08200	intergenic_region ; MODIFIER	silent_mutation	Average:93.497; most accessible tissue: Zhenshan97 flag leaf, score: 97.498	N	N	N	N
vg1104292362	T -> DEL	N	N	silent_mutation	Average:93.497; most accessible tissue: Zhenshan97 flag leaf, score: 97.498	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg1104292362	T	A	-0.04	-0.04	-0.05	-0.03	-0.03	-0.04

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1104292362	NA	3.23E-15	Grain_length	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1104292362	NA	5.37E-17	Grain_length	Ind_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1104292362	1.55E-07	1.72E-09	mr1218	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104292362	NA	4.58E-06	mr1347	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104292362	NA	4.35E-07	mr1583	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104292362	NA	3.23E-06	mr1622	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104292362	6.16E-07	NA	mr1638	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104292362	1.66E-06	6.16E-09	mr1638	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104292362	NA	1.32E-06	mr1904	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104292362	NA	2.63E-08	mr1942	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104292362	NA	4.33E-08	mr1174_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104292362	NA	1.60E-08	mr1347_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1104292362	NA	2.69E-09	mr1598_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251