\
| Variant ID: vg1101745249 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 1745249 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.76, G: 0.24, others allele: 0.00, population size: 250. )
AAAAATGTCATCTGTTTAAACTGGTTTTCTTACAGTAATCGATCATTTATCAACAGCACATTGTGCATGCAGCACTATTGAAATAAGTAGGAGCAACTTT[A/G]
GGTTAAATTTATGTAGGTAAGCATCCAAAGGGTTTAATATATTTACAGAATCATTAATGGTAGCATCAGAATTCAGGAGAGCTGAACTTGCTTCTTTTGT
ACAAAAGAAGCAAGTTCAGCTCTCCTGAATTCTGATGCTACCATTAATGATTCTGTAAATATATTAAACCCTTTGGATGCTTACCTACATAAATTTAACC[T/C]
AAAGTTGCTCCTACTTATTTCAATAGTGCTGCATGCACAATGTGCTGTTGATAAATGATCGATTACTGTAAGAAAACCAGTTTAAACAGATGACATTTTT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 64.60% | 35.40% | 0.02% | 0.00% | NA |
| All Indica | 2759 | 97.40% | 2.60% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 3.60% | 96.40% | 0.00% | 0.00% | NA |
| Aus | 269 | 92.90% | 7.10% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| Indica II | 465 | 97.40% | 2.60% | 0.00% | 0.00% | NA |
| Indica III | 913 | 97.50% | 2.50% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 95.90% | 4.10% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 2.90% | 97.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 4.60% | 95.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 3.70% | 96.30% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 18.80% | 81.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 48.90% | 50.00% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1101745249 | A -> G | LOC_Os11g04230.1 | downstream_gene_variant ; 3363.0bp to feature; MODIFIER | silent_mutation | Average:37.925; most accessible tissue: Callus, score: 86.679 | N | N | N | N |
| vg1101745249 | A -> G | LOC_Os11g04240.1 | intron_variant ; MODIFIER | silent_mutation | Average:37.925; most accessible tissue: Callus, score: 86.679 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1101745249 | NA | 4.02E-19 | Yield | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg1101745249 | NA | 1.00E-28 | mr1075 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1101745249 | NA | 8.35E-77 | mr1100 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1101745249 | NA | 1.19E-10 | mr1751 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1101745249 | NA | 3.27E-52 | mr1795 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1101745249 | NA | 1.99E-22 | mr1888 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1101745249 | NA | 1.04E-38 | mr1890 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1101745249 | NA | 1.12E-102 | mr1100_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1101745249 | NA | 6.94E-55 | mr1124_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1101745249 | NA | 9.87E-12 | mr1216_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1101745249 | NA | 5.07E-10 | mr1595_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1101745249 | NA | 2.20E-09 | mr1600_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1101745249 | NA | 7.05E-24 | mr1609_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1101745249 | NA | 2.06E-78 | mr1671_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1101745249 | NA | 1.86E-91 | mr1795_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1101745249 | NA | 5.37E-41 | mr1888_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |