Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1101640852:

Variant ID: vg1101640852 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 1640852
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AGAGGGGAAGGGTGTATGACAGGTGGGTCCCACAATTGTTATATATATATATAATGCTGACTGAACTGCCATATGTACGACACGTAGACCAAAACCACCG[C/T]
GGATTAGGTCGAGGAGGGTAATTCGTCCGGTTTGTATAGTTGGGGGTGAAGAATATCCGGTTTTATCGTTCAGGGGGGTAATTCGGACTACCGCGATAGT

Reverse complement sequence

ACTATCGCGGTAGTCCGAATTACCCCCCTGAACGATAAAACCGGATATTCTTCACCCCCAACTATACAAACCGGACGAATTACCCTCCTCGACCTAATCC[G/A]
CGGTGGTTTTGGTCTACGTGTCGTACATATGGCAGTTCAGTCAGCATTATATATATATATAACAATTGTGGGACCCACCTGTCATACACCCTTCCCCTCT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	81.50%	0.60%	8.84%	9.06%	NA
All Indica	2759	75.50%	0.00%	10.40%	14.06%	NA
All Japonica	1512	95.20%	1.90%	2.71%	0.26%	NA
Aus	269	59.10%	0.00%	29.00%	11.90%	NA
Indica I	595	18.50%	0.00%	30.59%	50.92%	NA
Indica II	465	92.00%	0.00%	5.81%	2.15%	NA
Indica III	913	99.70%	0.00%	0.33%	0.00%	NA
Indica Intermediate	786	80.90%	0.00%	9.54%	9.54%	NA
Temperate Japonica	767	93.00%	1.70%	5.08%	0.26%	NA
Tropical Japonica	504	99.40%	0.60%	0.00%	0.00%	NA
Japonica Intermediate	241	93.40%	5.00%	0.83%	0.83%	NA
VI/Aromatic	96	90.60%	0.00%	8.33%	1.04%	NA
Intermediate	90	92.20%	0.00%	4.44%	3.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1101640852	C -> T	LOC_Os11g04050.1	upstream_gene_variant ; 864.0bp to feature; MODIFIER	silent_mutation	Average:80.839; most accessible tissue: Minghui63 root, score: 92.332	N	N	N	N
vg1101640852	C -> T	LOC_Os11g04040.1	downstream_gene_variant ; 3936.0bp to feature; MODIFIER	silent_mutation	Average:80.839; most accessible tissue: Minghui63 root, score: 92.332	N	N	N	N
vg1101640852	C -> T	LOC_Os11g04060.1	downstream_gene_variant ; 340.0bp to feature; MODIFIER	silent_mutation	Average:80.839; most accessible tissue: Minghui63 root, score: 92.332	N	N	N	N
vg1101640852	C -> T	LOC_Os11g04050-LOC_Os11g04060	intergenic_region ; MODIFIER	silent_mutation	Average:80.839; most accessible tissue: Minghui63 root, score: 92.332	N	N	N	N
vg1101640852	C -> DEL	N	N	silent_mutation	Average:80.839; most accessible tissue: Minghui63 root, score: 92.332	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg1101640852	C	T	-0.05	-0.05	-0.04	-0.03	-0.03	-0.03

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1101640852	NA	3.44E-11	Heading_date	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1101640852	NA	6.71E-06	mr1354	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101640852	NA	3.07E-06	mr1598	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101640852	NA	7.70E-12	mr1904	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101640852	5.24E-06	6.64E-12	mr1904	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101640852	NA	6.66E-06	mr1060_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101640852	NA	9.41E-06	mr1170_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101640852	NA	4.20E-06	mr1558_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101640852	NA	1.32E-09	mr1565_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101640852	NA	9.33E-06	mr1712_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101640852	NA	5.96E-06	mr1756_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101640852	3.38E-06	5.73E-06	mr1821_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101640852	NA	5.31E-06	mr1838_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101640852	NA	4.27E-09	mr1861_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251