\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1101640852:

Variant ID: vg1101640852 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 1640852
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AGAGGGGAAGGGTGTATGACAGGTGGGTCCCACAATTGTTATATATATATATAATGCTGACTGAACTGCCATATGTACGACACGTAGACCAAAACCACCG[C/T]
GGATTAGGTCGAGGAGGGTAATTCGTCCGGTTTGTATAGTTGGGGGTGAAGAATATCCGGTTTTATCGTTCAGGGGGGTAATTCGGACTACCGCGATAGT

Reverse complement sequence

ACTATCGCGGTAGTCCGAATTACCCCCCTGAACGATAAAACCGGATATTCTTCACCCCCAACTATACAAACCGGACGAATTACCCTCCTCGACCTAATCC[G/A]
CGGTGGTTTTGGTCTACGTGTCGTACATATGGCAGTTCAGTCAGCATTATATATATATATAACAATTGTGGGACCCACCTGTCATACACCCTTCCCCTCT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 81.50% 0.60% 8.84% 9.06% NA
All Indica  2759 75.50% 0.00% 10.40% 14.06% NA
All Japonica  1512 95.20% 1.90% 2.71% 0.26% NA
Aus  269 59.10% 0.00% 29.00% 11.90% NA
Indica I  595 18.50% 0.00% 30.59% 50.92% NA
Indica II  465 92.00% 0.00% 5.81% 2.15% NA
Indica III  913 99.70% 0.00% 0.33% 0.00% NA
Indica Intermediate  786 80.90% 0.00% 9.54% 9.54% NA
Temperate Japonica  767 93.00% 1.70% 5.08% 0.26% NA
Tropical Japonica  504 99.40% 0.60% 0.00% 0.00% NA
Japonica Intermediate  241 93.40% 5.00% 0.83% 0.83% NA
VI/Aromatic  96 90.60% 0.00% 8.33% 1.04% NA
Intermediate  90 92.20% 0.00% 4.44% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1101640852 C -> T LOC_Os11g04050.1 upstream_gene_variant ; 864.0bp to feature; MODIFIER silent_mutation Average:80.839; most accessible tissue: Minghui63 root, score: 92.332 N N N N
vg1101640852 C -> T LOC_Os11g04040.1 downstream_gene_variant ; 3936.0bp to feature; MODIFIER silent_mutation Average:80.839; most accessible tissue: Minghui63 root, score: 92.332 N N N N
vg1101640852 C -> T LOC_Os11g04060.1 downstream_gene_variant ; 340.0bp to feature; MODIFIER silent_mutation Average:80.839; most accessible tissue: Minghui63 root, score: 92.332 N N N N
vg1101640852 C -> T LOC_Os11g04050-LOC_Os11g04060 intergenic_region ; MODIFIER silent_mutation Average:80.839; most accessible tissue: Minghui63 root, score: 92.332 N N N N
vg1101640852 C -> DEL N N silent_mutation Average:80.839; most accessible tissue: Minghui63 root, score: 92.332 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1101640852 C T -0.05 -0.05 -0.04 -0.03 -0.03 -0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1101640852 NA 3.44E-11 Heading_date All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1101640852 NA 6.71E-06 mr1354 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101640852 NA 3.07E-06 mr1598 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101640852 NA 7.70E-12 mr1904 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101640852 5.24E-06 6.64E-12 mr1904 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101640852 NA 6.66E-06 mr1060_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101640852 NA 9.41E-06 mr1170_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101640852 NA 4.20E-06 mr1558_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101640852 NA 1.32E-09 mr1565_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101640852 NA 9.33E-06 mr1712_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101640852 NA 5.96E-06 mr1756_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101640852 3.38E-06 5.73E-06 mr1821_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101640852 NA 5.31E-06 mr1838_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101640852 NA 4.27E-09 mr1861_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251