\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1101380599:

Variant ID: vg1101380599 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 1380599
Reference Allele: AAlternative Allele: C
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.93, A: 0.07, others allele: 0.00, population size: 227. )

Flanking Sequence (100 bp) in Reference Genome:


CTCTGCATGTTCCCAAGTAGTGGAAGCAGCGCGCCTGCACATTGCATCTGCATGTTACTGCTACTGCAATCAAGCTAGTCTGTATCTGTAACACAAGTTA[A/C]
AAGAACAATATATATAAGCCAGCATTGCTCCCCCTTGATGCTCAACTGCCATACACGCACACAGTACTGCAACTACCACCACATCACGGCTGATCAAGAA

Reverse complement sequence

TTCTTGATCAGCCGTGATGTGGTGGTAGTTGCAGTACTGTGTGCGTGTATGGCAGTTGAGCATCAAGGGGGAGCAATGCTGGCTTATATATATTGTTCTT[T/G]
TAACTTGTGTTACAGATACAGACTAGCTTGATTGCAGTAGCAGTAACATGCAGATGCAATGTGCAGGCGCGCTGCTTCCACTACTTGGGAACATGCAGAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 67.50% 32.30% 0.02% 0.21% NA
All Indica  2759 99.20% 0.70% 0.00% 0.14% NA
All Japonica  1512 4.00% 95.80% 0.00% 0.20% NA
Aus  269 99.30% 0.40% 0.00% 0.37% NA
Indica I  595 99.50% 0.20% 0.00% 0.34% NA
Indica II  465 98.50% 1.30% 0.00% 0.22% NA
Indica III  913 99.80% 0.20% 0.00% 0.00% NA
Indica Intermediate  786 98.70% 1.10% 0.00% 0.13% NA
Temperate Japonica  767 3.10% 96.70% 0.00% 0.13% NA
Tropical Japonica  504 4.80% 95.00% 0.00% 0.20% NA
Japonica Intermediate  241 5.40% 94.20% 0.00% 0.41% NA
VI/Aromatic  96 75.00% 25.00% 0.00% 0.00% NA
Intermediate  90 56.70% 40.00% 1.11% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1101380599 A -> DEL N N silent_mutation Average:71.71; most accessible tissue: Zhenshan97 root, score: 86.991 N N N N
vg1101380599 A -> C LOC_Os11g03550.1 upstream_gene_variant ; 4868.0bp to feature; MODIFIER silent_mutation Average:71.71; most accessible tissue: Zhenshan97 root, score: 86.991 N N N N
vg1101380599 A -> C LOC_Os11g03560.1 upstream_gene_variant ; 113.0bp to feature; MODIFIER silent_mutation Average:71.71; most accessible tissue: Zhenshan97 root, score: 86.991 N N N N
vg1101380599 A -> C LOC_Os11g03570.1 downstream_gene_variant ; 1186.0bp to feature; MODIFIER silent_mutation Average:71.71; most accessible tissue: Zhenshan97 root, score: 86.991 N N N N
vg1101380599 A -> C LOC_Os11g03550-LOC_Os11g03560 intergenic_region ; MODIFIER silent_mutation Average:71.71; most accessible tissue: Zhenshan97 root, score: 86.991 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1101380599 NA 2.66E-20 Yield All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1101380599 NA 3.27E-68 mr1027 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101380599 NA 3.75E-23 mr1122 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101380599 NA 1.48E-81 mr1134 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101380599 NA 5.81E-44 mr1194 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101380599 NA 4.40E-09 mr1336 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101380599 NA 3.52E-87 mr1504 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101380599 NA 5.74E-18 mr1529 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101380599 NA 6.99E-85 mr1672 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101380599 NA 4.99E-35 mr1682 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101380599 2.13E-06 2.13E-06 mr1717 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101380599 NA 4.21E-92 mr1758 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101380599 NA 5.85E-18 mr1767 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101380599 NA 5.53E-21 mr1838 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101380599 NA 1.85E-22 mr1839 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101380599 NA 1.87E-23 mr1917 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101380599 NA 2.70E-82 mr1027_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101380599 NA 2.05E-30 mr1105_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101380599 NA 2.48E-22 mr1242_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101380599 NA 1.42E-06 mr1275_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101380599 NA 3.46E-14 mr1529_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101380599 NA 6.65E-16 mr1557_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101380599 NA 4.46E-121 mr1672_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101380599 NA 9.03E-130 mr1758_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101380599 NA 8.55E-17 mr1767_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101380599 NA 5.02E-41 mr1944_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251