\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1101297328:

Variant ID: vg1101297328 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 1297328
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.01, others allele: 0.00, population size: 300. )

Flanking Sequence (100 bp) in Reference Genome:


TCATCCCTAAATTTCCTTCTTCTTTTGTGCTTTGTGTTGTGCACAAGTCACTGAATCTCTGTATTTTGACTTTCTCCCCCGCACTACTTCACCTTTTCTT[T/C]
AAGATGTCCATGTCAGTAAACAAGAACCGGTCACCATCTTAGCAATTAGACGAATCTCCATCAACCTAAGAGACGCATAAGACGTTTCGTCAAGTCAATT

Reverse complement sequence

AATTGACTTGACGAAACGTCTTATGCGTCTCTTAGGTTGATGGAGATTCGTCTAATTGCTAAGATGGTGACCGGTTCTTGTTTACTGACATGGACATCTT[A/G]
AAGAAAAGGTGAAGTAGTGCGGGGGAGAAAGTCAAAATACAGAGATTCAGTGACTTGTGCACAACACAAAGCACAAAAGAAGAAGGAAATTTAGGGATGA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 66.90% 32.90% 0.08% 0.15% NA
All Indica  2759 98.90% 0.80% 0.07% 0.22% NA
All Japonica  1512 3.60% 96.30% 0.07% 0.00% NA
Aus  269 95.50% 4.50% 0.00% 0.00% NA
Indica I  595 99.30% 0.30% 0.00% 0.34% NA
Indica II  465 98.30% 1.50% 0.00% 0.22% NA
Indica III  913 99.60% 0.20% 0.00% 0.22% NA
Indica Intermediate  786 98.30% 1.30% 0.25% 0.13% NA
Temperate Japonica  767 2.90% 97.00% 0.13% 0.00% NA
Tropical Japonica  504 4.00% 96.00% 0.00% 0.00% NA
Japonica Intermediate  241 5.40% 94.60% 0.00% 0.00% NA
VI/Aromatic  96 72.90% 27.10% 0.00% 0.00% NA
Intermediate  90 55.60% 42.20% 1.11% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1101297328 T -> DEL N N silent_mutation Average:82.537; most accessible tissue: Zhenshan97 flower, score: 97.445 N N N N
vg1101297328 T -> C LOC_Os11g03410.1 upstream_gene_variant ; 4974.0bp to feature; MODIFIER silent_mutation Average:82.537; most accessible tissue: Zhenshan97 flower, score: 97.445 N N N N
vg1101297328 T -> C LOC_Os11g03420.1 upstream_gene_variant ; 922.0bp to feature; MODIFIER silent_mutation Average:82.537; most accessible tissue: Zhenshan97 flower, score: 97.445 N N N N
vg1101297328 T -> C LOC_Os11g03410-LOC_Os11g03420 intergenic_region ; MODIFIER silent_mutation Average:82.537; most accessible tissue: Zhenshan97 flower, score: 97.445 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1101297328 T C -0.2 0.0 0.03 0.01 -0.02 -0.06

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1101297328 NA 4.66E-21 Yield All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1101297328 NA 4.09E-67 mr1027 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101297328 NA 7.62E-44 mr1194 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101297328 NA 2.45E-09 mr1336 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101297328 NA 6.60E-19 mr1529 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101297328 NA 1.54E-81 mr1672 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101297328 NA 3.74E-49 mr1692 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101297328 NA 6.33E-90 mr1758 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101297328 NA 4.78E-21 mr1838 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101297328 NA 4.09E-22 mr1839 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101297328 NA 3.28E-22 mr1888 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101297328 NA 7.66E-86 mr1027_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101297328 NA 2.12E-15 mr1148_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101297328 NA 3.06E-39 mr1152_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101297328 NA 5.91E-07 mr1275_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101297328 NA 3.00E-10 mr1506_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101297328 NA 8.66E-16 mr1529_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101297328 NA 7.06E-14 mr1575_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101297328 NA 8.94E-12 mr1636_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101297328 NA 4.76E-10 mr1646_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101297328 NA 2.18E-07 mr1683_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101297328 NA 1.14E-17 mr1767_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101297328 NA 4.27E-13 mr1838_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101297328 NA 8.12E-41 mr1944_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251