\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1101271092:

Variant ID: vg1101271092 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 1271092
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.02, others allele: 0.00, population size: 281. )

Flanking Sequence (100 bp) in Reference Genome:


ATAGCTATACATTCGTGCAATTTTGTTGATTGCTTTGTTGTTTAGTTTTGGTCTTCTGTACAAAGATCATGACATTTTGCTTCGTGAGTTTCTTGCTGGT[A/G]
ATGCTGATTGATAGATGTTCTCTTGCGGCACATATTTTTGGAACTTGCTATATAATACTCTAGCCTTTAATTTGGTGGCATTTGTGGATGAGACTTCTTC

Reverse complement sequence

GAAGAAGTCTCATCCACAAATGCCACCAAATTAAAGGCTAGAGTATTATATAGCAAGTTCCAAAAATATGTGCCGCAAGAGAACATCTATCAATCAGCAT[T/C]
ACCAGCAAGAAACTCACGAAGCAAAATGTCATGATCTTTGTACAGAAGACCAAAACTAAACAACAAAGCAATCAACAAAATTGCACGAATGTATAGCTAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 66.80% 33.00% 0.06% 0.13% NA
All Indica  2759 99.00% 0.80% 0.04% 0.18% NA
All Japonica  1512 3.20% 96.70% 0.07% 0.00% NA
Aus  269 94.40% 5.60% 0.00% 0.00% NA
Indica I  595 99.30% 0.50% 0.00% 0.17% NA
Indica II  465 98.30% 1.50% 0.00% 0.22% NA
Indica III  913 99.70% 0.20% 0.00% 0.11% NA
Indica Intermediate  786 98.50% 1.10% 0.13% 0.25% NA
Temperate Japonica  767 2.90% 97.00% 0.13% 0.00% NA
Tropical Japonica  504 3.00% 97.00% 0.00% 0.00% NA
Japonica Intermediate  241 5.00% 95.00% 0.00% 0.00% NA
VI/Aromatic  96 77.10% 22.90% 0.00% 0.00% NA
Intermediate  90 54.40% 43.30% 1.11% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1101271092 A -> DEL N N silent_mutation Average:44.989; most accessible tissue: Minghui63 root, score: 74.461 N N N N
vg1101271092 A -> G LOC_Os11g03370.1 3_prime_UTR_variant ; 245.0bp to feature; MODIFIER silent_mutation Average:44.989; most accessible tissue: Minghui63 root, score: 74.461 N N N N
vg1101271092 A -> G LOC_Os11g03360.1 upstream_gene_variant ; 3593.0bp to feature; MODIFIER silent_mutation Average:44.989; most accessible tissue: Minghui63 root, score: 74.461 N N N N
vg1101271092 A -> G LOC_Os11g03380.1 downstream_gene_variant ; 3362.0bp to feature; MODIFIER silent_mutation Average:44.989; most accessible tissue: Minghui63 root, score: 74.461 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1101271092 NA 3.90E-21 Yield All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1101271092 NA 4.53E-26 mr1024 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101271092 NA 4.19E-66 mr1027 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101271092 NA 2.60E-43 mr1194 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101271092 NA 1.31E-27 mr1309 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101271092 NA 4.43E-09 mr1336 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101271092 NA 7.17E-19 mr1529 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101271092 NA 1.59E-90 mr1758 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101271092 NA 2.14E-21 mr1839 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101271092 NA 2.49E-06 mr1020_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101271092 NA 6.81E-24 mr1024_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101271092 NA 5.44E-85 mr1027_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101271092 7.15E-06 NA mr1063_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101271092 NA 4.45E-08 mr1134_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101271092 NA 7.99E-16 mr1148_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101271092 NA 5.10E-52 mr1194_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101271092 NA 7.72E-09 mr1198_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101271092 NA 1.43E-07 mr1275_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101271092 NA 2.46E-09 mr1504_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101271092 NA 3.52E-10 mr1506_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101271092 NA 1.84E-15 mr1529_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101271092 NA 2.38E-14 mr1575_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101271092 NA 2.89E-10 mr1646_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101271092 NA 2.64E-06 mr1672_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1101271092 NA 2.88E-17 mr1767_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251