\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1014789649:

Variant ID: vg1014789649 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 14789649
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.97, C: 0.03, others allele: 0.00, population size: 204. )

Flanking Sequence (100 bp) in Reference Genome:


AGGCGCGCACGCACGAGTAGAAAAGTCCTAGCCTCCCTGTTTGTGCTGAGGATTTGTACTCCGCTTTTCCTTTTTTTAAAAAAGAAATGCTCCACGTATT[T/C]
AAAACATTTACTTAACATGTGCAATGAACTTTCAATTTCGAAATCTCAAACATTCAATTCGAAAATGTCAGCACAAATTAAGCACAAGACTTTTAATCAT

Reverse complement sequence

ATGATTAAAAGTCTTGTGCTTAATTTGTGCTGACATTTTCGAATTGAATGTTTGAGATTTCGAAATTGAAAGTTCATTGCACATGTTAAGTAAATGTTTT[A/G]
AATACGTGGAGCATTTCTTTTTTAAAAAAAGGAAAAGCGGAGTACAAATCCTCAGCACAAACAGGGAGGCTAGGACTTTTCTACTCGTGCGTGCGCGCCT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 60.90% 39.00% 0.04% 0.00% NA
All Indica  2759 97.90% 2.00% 0.04% 0.00% NA
All Japonica  1512 0.80% 99.20% 0.00% 0.00% NA
Aus  269 47.60% 52.00% 0.37% 0.00% NA
Indica I  595 99.30% 0.70% 0.00% 0.00% NA
Indica II  465 97.20% 2.80% 0.00% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 95.00% 4.80% 0.13% 0.00% NA
Temperate Japonica  767 0.10% 99.90% 0.00% 0.00% NA
Tropical Japonica  504 1.40% 98.60% 0.00% 0.00% NA
Japonica Intermediate  241 1.70% 98.30% 0.00% 0.00% NA
VI/Aromatic  96 1.00% 99.00% 0.00% 0.00% NA
Intermediate  90 41.10% 58.90% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1014789649 T -> C LOC_Os10g28420.1 downstream_gene_variant ; 2991.0bp to feature; MODIFIER silent_mutation Average:65.735; most accessible tissue: Callus, score: 87.267 N N N N
vg1014789649 T -> C LOC_Os10g28430.1 downstream_gene_variant ; 512.0bp to feature; MODIFIER silent_mutation Average:65.735; most accessible tissue: Callus, score: 87.267 N N N N
vg1014789649 T -> C LOC_Os10g28420-LOC_Os10g28430 intergenic_region ; MODIFIER silent_mutation Average:65.735; most accessible tissue: Callus, score: 87.267 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1014789649 NA 7.16E-21 Yield All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1014789649 NA 1.41E-47 mr1509 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014789649 NA 5.31E-49 mr1558 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014789649 NA 3.36E-21 mr1580 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014789649 NA 7.53E-42 mr1591 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014789649 NA 1.79E-17 mr1825 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014789649 NA 5.81E-10 mr1379_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014789649 NA 1.16E-06 mr1559_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251