\
| Variant ID: vg1014789649 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 14789649 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.97, C: 0.03, others allele: 0.00, population size: 204. )
AGGCGCGCACGCACGAGTAGAAAAGTCCTAGCCTCCCTGTTTGTGCTGAGGATTTGTACTCCGCTTTTCCTTTTTTTAAAAAAGAAATGCTCCACGTATT[T/C]
AAAACATTTACTTAACATGTGCAATGAACTTTCAATTTCGAAATCTCAAACATTCAATTCGAAAATGTCAGCACAAATTAAGCACAAGACTTTTAATCAT
ATGATTAAAAGTCTTGTGCTTAATTTGTGCTGACATTTTCGAATTGAATGTTTGAGATTTCGAAATTGAAAGTTCATTGCACATGTTAAGTAAATGTTTT[A/G]
AATACGTGGAGCATTTCTTTTTTAAAAAAAGGAAAAGCGGAGTACAAATCCTCAGCACAAACAGGGAGGCTAGGACTTTTCTACTCGTGCGTGCGCGCCT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 60.90% | 39.00% | 0.04% | 0.00% | NA |
| All Indica | 2759 | 97.90% | 2.00% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 0.80% | 99.20% | 0.00% | 0.00% | NA |
| Aus | 269 | 47.60% | 52.00% | 0.37% | 0.00% | NA |
| Indica I | 595 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Indica II | 465 | 97.20% | 2.80% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 95.00% | 4.80% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 0.10% | 99.90% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 1.40% | 98.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 1.70% | 98.30% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 1.00% | 99.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 41.10% | 58.90% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1014789649 | T -> C | LOC_Os10g28420.1 | downstream_gene_variant ; 2991.0bp to feature; MODIFIER | silent_mutation | Average:65.735; most accessible tissue: Callus, score: 87.267 | N | N | N | N |
| vg1014789649 | T -> C | LOC_Os10g28430.1 | downstream_gene_variant ; 512.0bp to feature; MODIFIER | silent_mutation | Average:65.735; most accessible tissue: Callus, score: 87.267 | N | N | N | N |
| vg1014789649 | T -> C | LOC_Os10g28420-LOC_Os10g28430 | intergenic_region ; MODIFIER | silent_mutation | Average:65.735; most accessible tissue: Callus, score: 87.267 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1014789649 | NA | 7.16E-21 | Yield | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg1014789649 | NA | 1.41E-47 | mr1509 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1014789649 | NA | 5.31E-49 | mr1558 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1014789649 | NA | 3.36E-21 | mr1580 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1014789649 | NA | 7.53E-42 | mr1591 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1014789649 | NA | 1.79E-17 | mr1825 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1014789649 | NA | 5.81E-10 | mr1379_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1014789649 | NA | 1.16E-06 | mr1559_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |