Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1014789649:

Variant ID: vg1014789649 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 14789649
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.97, C: 0.03, others allele: 0.00, population size: 204. )

Flanking Sequence (100 bp) in Reference Genome:

AGGCGCGCACGCACGAGTAGAAAAGTCCTAGCCTCCCTGTTTGTGCTGAGGATTTGTACTCCGCTTTTCCTTTTTTTAAAAAAGAAATGCTCCACGTATT[T/C]
AAAACATTTACTTAACATGTGCAATGAACTTTCAATTTCGAAATCTCAAACATTCAATTCGAAAATGTCAGCACAAATTAAGCACAAGACTTTTAATCAT

Reverse complement sequence

ATGATTAAAAGTCTTGTGCTTAATTTGTGCTGACATTTTCGAATTGAATGTTTGAGATTTCGAAATTGAAAGTTCATTGCACATGTTAAGTAAATGTTTT[A/G]
AATACGTGGAGCATTTCTTTTTTAAAAAAAGGAAAAGCGGAGTACAAATCCTCAGCACAAACAGGGAGGCTAGGACTTTTCTACTCGTGCGTGCGCGCCT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	60.90%	39.00%	0.04%	0.00%	NA
All Indica	2759	97.90%	2.00%	0.04%	0.00%	NA
All Japonica	1512	0.80%	99.20%	0.00%	0.00%	NA
Aus	269	47.60%	52.00%	0.37%	0.00%	NA
Indica I	595	99.30%	0.70%	0.00%	0.00%	NA
Indica II	465	97.20%	2.80%	0.00%	0.00%	NA
Indica III	913	99.90%	0.10%	0.00%	0.00%	NA
Indica Intermediate	786	95.00%	4.80%	0.13%	0.00%	NA
Temperate Japonica	767	0.10%	99.90%	0.00%	0.00%	NA
Tropical Japonica	504	1.40%	98.60%	0.00%	0.00%	NA
Japonica Intermediate	241	1.70%	98.30%	0.00%	0.00%	NA
VI/Aromatic	96	1.00%	99.00%	0.00%	0.00%	NA
Intermediate	90	41.10%	58.90%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1014789649	T -> C	LOC_Os10g28420.1	downstream_gene_variant ; 2991.0bp to feature; MODIFIER	silent_mutation	Average:65.735; most accessible tissue: Callus, score: 87.267	N	N	N	N
vg1014789649	T -> C	LOC_Os10g28430.1	downstream_gene_variant ; 512.0bp to feature; MODIFIER	silent_mutation	Average:65.735; most accessible tissue: Callus, score: 87.267	N	N	N	N
vg1014789649	T -> C	LOC_Os10g28420-LOC_Os10g28430	intergenic_region ; MODIFIER	silent_mutation	Average:65.735; most accessible tissue: Callus, score: 87.267	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1014789649	NA	7.16E-21	Yield	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1014789649	NA	1.41E-47	mr1509	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014789649	NA	5.31E-49	mr1558	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014789649	NA	3.36E-21	mr1580	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014789649	NA	7.53E-42	mr1591	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014789649	NA	1.79E-17	mr1825	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014789649	NA	5.81E-10	mr1379_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1014789649	NA	1.16E-06	mr1559_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251