\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1013802723:

Variant ID: vg1013802723 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 13802723
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 54. )

Flanking Sequence (100 bp) in Reference Genome:


GCAGTTTTTACTCCTGGTTCATAACCCTCCTATAGTTCCGGTTTTTCAACCGGAACTACGAATCCAGGACTAAAGATATCTTTAGTCCCGGGTGAAAAAA[T/C]
CGAGAGTAAAAATTCATTTTTAATCCCGGTTGGTAACACCAACCGGGACTAAAGAGGCTAGATCCGGTTGCTACTTTATTCTATTCTTTTCTTTATTGTT

Reverse complement sequence

AACAATAAAGAAAAGAATAGAATAAAGTAGCAACCGGATCTAGCCTCTTTAGTCCCGGTTGGTGTTACCAACCGGGATTAAAAATGAATTTTTACTCTCG[A/G]
TTTTTTCACCCGGGACTAAAGATATCTTTAGTCCTGGATTCGTAGTTCCGGTTGAAAAACCGGAACTATAGGAGGGTTATGAACCAGGAGTAAAAACTGC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 66.40% 27.00% 1.97% 4.61% NA
All Indica  2759 64.50% 26.70% 2.03% 6.71% NA
All Japonica  1512 63.50% 32.10% 2.31% 2.12% NA
Aus  269 99.30% 0.70% 0.00% 0.00% NA
Indica I  595 97.00% 1.80% 0.00% 1.18% NA
Indica II  465 43.20% 42.40% 2.58% 11.83% NA
Indica III  913 55.80% 34.20% 3.18% 6.90% NA
Indica Intermediate  786 62.70% 27.70% 1.91% 7.63% NA
Temperate Japonica  767 93.60% 5.70% 0.26% 0.39% NA
Tropical Japonica  504 31.00% 59.90% 5.16% 3.97% NA
Japonica Intermediate  241 35.70% 57.70% 2.90% 3.73% NA
VI/Aromatic  96 67.70% 32.30% 0.00% 0.00% NA
Intermediate  90 72.20% 24.40% 2.22% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1013802723 T -> C LOC_Os10g26500.1 upstream_gene_variant ; 2088.0bp to feature; MODIFIER silent_mutation Average:81.764; most accessible tissue: Zhenshan97 panicle, score: 97.011 N N N N
vg1013802723 T -> C LOC_Os10g26490-LOC_Os10g26500 intergenic_region ; MODIFIER silent_mutation Average:81.764; most accessible tissue: Zhenshan97 panicle, score: 97.011 N N N N
vg1013802723 T -> DEL N N silent_mutation Average:81.764; most accessible tissue: Zhenshan97 panicle, score: 97.011 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1013802723 T C 0.0 0.0 0.0 0.0 0.0 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1013802723 NA 3.18E-17 Grain_length All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1013802723 NA 3.06E-15 Grain_length Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1013802723 NA 1.46E-07 mr1022 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013802723 NA 6.21E-06 mr1236 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013802723 NA 4.70E-06 mr1518 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013802723 2.50E-07 3.27E-16 mr1533 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013802723 NA 3.58E-10 mr1769 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013802723 NA 2.62E-13 mr1769 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013802723 6.11E-06 NA mr1980 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013802723 6.45E-06 2.53E-17 mr1980 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013802723 NA 4.77E-06 mr1062_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013802723 NA 2.00E-07 mr1120_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013802723 NA 6.49E-09 mr1156_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013802723 NA 4.86E-06 mr1224_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013802723 NA 1.45E-08 mr1347_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013802723 NA 1.20E-13 mr1410_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013802723 5.50E-11 NA mr1533_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013802723 1.03E-09 2.49E-24 mr1533_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013802723 NA 3.67E-10 mr1552_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013802723 NA 2.57E-06 mr1743_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013802723 NA 1.67E-13 mr1769_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013802723 NA 6.05E-09 mr1916_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013802723 2.61E-08 NA mr1980_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013802723 1.19E-06 1.69E-12 mr1980_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251