\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1013801258:

Variant ID: vg1013801258 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 13801258
Reference Allele: CAlternative Allele: G
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.94, G: 0.05, others allele: 0.00, population size: 218. )

Flanking Sequence (100 bp) in Reference Genome:


ATCTCGTTTCAACTAGCTAGGTGCACTTATTAAGAAAAAAAACACCCCCCCCCCCCAAACTCACCACAAATCAATAAATGTGAAAAGTGCAGAAATGGTG[C/G]
CATCATATAGTTTGATGATAAGGTGATTTGTGGAAATGTGTCCTATAGCTTCAATCTTTAATGCGGCAGTTAATGGTAGACTTAACTTTTCCTTGTGGTT

Reverse complement sequence

AACCACAAGGAAAAGTTAAGTCTACCATTAACTGCCGCATTAAAGATTGAAGCTATAGGACACATTTCCACAAATCACCTTATCATCAAACTATATGATG[G/C]
CACCATTTCTGCACTTTTCACATTTATTGATTTGTGGTGAGTTTGGGGGGGGGGGGTGTTTTTTTTCTTAATAAGTGCACCTAGCTAGTTGAAACGAGAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 65.90% 34.00% 0.08% 0.00% NA
All Indica  2759 64.20% 35.70% 0.11% 0.00% NA
All Japonica  1512 63.00% 37.00% 0.07% 0.00% NA
Aus  269 98.90% 1.10% 0.00% 0.00% NA
Indica I  595 97.10% 2.90% 0.00% 0.00% NA
Indica II  465 41.50% 58.10% 0.43% 0.00% NA
Indica III  913 56.20% 43.70% 0.11% 0.00% NA
Indica Intermediate  786 62.00% 38.00% 0.00% 0.00% NA
Temperate Japonica  767 93.50% 6.50% 0.00% 0.00% NA
Tropical Japonica  504 29.80% 70.00% 0.20% 0.00% NA
Japonica Intermediate  241 35.30% 64.70% 0.00% 0.00% NA
VI/Aromatic  96 65.60% 34.40% 0.00% 0.00% NA
Intermediate  90 71.10% 28.90% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1013801258 C -> G LOC_Os10g26500.1 upstream_gene_variant ; 3553.0bp to feature; MODIFIER silent_mutation Average:53.755; most accessible tissue: Callus, score: 91.605 N N N N
vg1013801258 C -> G LOC_Os10g26490-LOC_Os10g26500 intergenic_region ; MODIFIER silent_mutation Average:53.755; most accessible tissue: Callus, score: 91.605 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1013801258 C G 0.0 -0.02 -0.02 -0.02 -0.05 -0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1013801258 NA 1.47E-16 Grain_length All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1013801258 NA 3.06E-15 Grain_length Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1013801258 NA 1.46E-07 mr1022 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013801258 NA 6.21E-06 mr1236 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013801258 NA 4.70E-06 mr1518 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013801258 2.86E-06 NA mr1533 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013801258 2.50E-07 3.27E-16 mr1533 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013801258 NA 2.62E-13 mr1769 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013801258 1.14E-06 NA mr1980 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013801258 6.45E-06 2.53E-17 mr1980 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013801258 NA 6.49E-09 mr1156_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013801258 NA 4.86E-06 mr1224_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013801258 NA 6.41E-08 mr1347_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013801258 NA 1.60E-13 mr1410_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013801258 2.03E-10 NA mr1533_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013801258 1.03E-09 2.49E-24 mr1533_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013801258 NA 3.67E-10 mr1552_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013801258 NA 8.80E-06 mr1641_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013801258 NA 1.67E-13 mr1769_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013801258 NA 6.90E-06 mr1838_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013801258 NA 6.05E-09 mr1916_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013801258 1.16E-07 NA mr1980_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1013801258 1.19E-06 1.69E-12 mr1980_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251