Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1011696221:

Variant ID: vg1011696221 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 11696221
Reference Allele: A	Alternative Allele: T
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 232. )

Flanking Sequence (100 bp) in Reference Genome:

CTCTATCTATTGCATATAACATAAGTTGTACAACCAGTGCCCTCATTCATCAATTAACAAAGATTTTTTAGTCTAAGGCGTTTATCGTCTCATGTCACAC[A/T]
CACGTAGCTATATTTTTTATATTATGGATATCATGCGTTCATGTTGTTTAGCACTTAATCATATAATTATTACGATGGGTCATTTATTGATTATTGTATT

Reverse complement sequence

AATACAATAATCAATAAATGACCCATCGTAATAATTATATGATTAAGTGCTAAACAACATGAACGCATGATATCCATAATATAAAAAATATAGCTACGTG[T/A]
GTGTGACATGAGACGATAAACGCCTTAGACTAAAAAATCTTTGTTAATTGATGAATGAGGGCACTGGTTGTACAACTTATGTTATATGCAATAGATAGAG

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	90.00%	9.20%	0.80%	0.00%	NA
All Indica	2759	99.70%	0.10%	0.11%	0.00%	NA
All Japonica	1512	70.20%	27.80%	1.98%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	99.40%	0.40%	0.22%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	99.50%	0.30%	0.25%	0.00%	NA
Temperate Japonica	767	43.30%	53.60%	3.13%	0.00%	NA
Tropical Japonica	504	99.20%	0.40%	0.40%	0.00%	NA
Japonica Intermediate	241	95.40%	2.90%	1.66%	0.00%	NA
VI/Aromatic	96	94.80%	0.00%	5.21%	0.00%	NA
Intermediate	90	88.90%	11.10%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1011696221	A -> T	LOC_Os10g22560.1	upstream_gene_variant ; 1182.0bp to feature; MODIFIER	silent_mutation	Average:36.14; most accessible tissue: Minghui63 panicle, score: 68.46	N	N	N	N
vg1011696221	A -> T	LOC_Os10g22560.2	upstream_gene_variant ; 1182.0bp to feature; MODIFIER	silent_mutation	Average:36.14; most accessible tissue: Minghui63 panicle, score: 68.46	N	N	N	N
vg1011696221	A -> T	LOC_Os10g22560.3	upstream_gene_variant ; 1182.0bp to feature; MODIFIER	silent_mutation	Average:36.14; most accessible tissue: Minghui63 panicle, score: 68.46	N	N	N	N
vg1011696221	A -> T	LOC_Os10g22570.1	downstream_gene_variant ; 2771.0bp to feature; MODIFIER	silent_mutation	Average:36.14; most accessible tissue: Minghui63 panicle, score: 68.46	N	N	N	N
vg1011696221	A -> T	LOC_Os10g22560-LOC_Os10g22570	intergenic_region ; MODIFIER	silent_mutation	Average:36.14; most accessible tissue: Minghui63 panicle, score: 68.46	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1011696221	NA	9.63E-10	Heading_date	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1011696221	NA	9.38E-15	Spikelet_length	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1011696221	NA	5.41E-07	mr1163	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011696221	NA	3.28E-06	mr1330	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011696221	NA	1.68E-09	mr1486	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011696221	NA	6.42E-08	mr1627	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011696221	NA	1.90E-07	mr1763	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011696221	NA	6.17E-06	mr1829	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011696221	8.20E-07	5.89E-13	mr1902	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011696221	NA	1.82E-08	mr1902	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011696221	NA	1.45E-09	mr1010_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011696221	NA	1.59E-06	mr1182_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011696221	NA	9.89E-06	mr1206_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011696221	NA	1.75E-07	mr1229_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011696221	NA	1.02E-06	mr1229_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011696221	NA	4.14E-06	mr1263_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011696221	NA	5.52E-07	mr1263_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011696221	NA	2.72E-06	mr1354_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011696221	NA	1.38E-06	mr1627_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011696221	NA	2.30E-06	mr1763_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011696221	NA	4.67E-09	mr1880_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011696221	NA	6.01E-08	mr1880_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011696221	NA	2.26E-07	mr1902_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251