\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1011696221:

Variant ID: vg1011696221 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 11696221
Reference Allele: AAlternative Allele: T
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 232. )

Flanking Sequence (100 bp) in Reference Genome:


CTCTATCTATTGCATATAACATAAGTTGTACAACCAGTGCCCTCATTCATCAATTAACAAAGATTTTTTAGTCTAAGGCGTTTATCGTCTCATGTCACAC[A/T]
CACGTAGCTATATTTTTTATATTATGGATATCATGCGTTCATGTTGTTTAGCACTTAATCATATAATTATTACGATGGGTCATTTATTGATTATTGTATT

Reverse complement sequence

AATACAATAATCAATAAATGACCCATCGTAATAATTATATGATTAAGTGCTAAACAACATGAACGCATGATATCCATAATATAAAAAATATAGCTACGTG[T/A]
GTGTGACATGAGACGATAAACGCCTTAGACTAAAAAATCTTTGTTAATTGATGAATGAGGGCACTGGTTGTACAACTTATGTTATATGCAATAGATAGAG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 90.00% 9.20% 0.80% 0.00% NA
All Indica  2759 99.70% 0.10% 0.11% 0.00% NA
All Japonica  1512 70.20% 27.80% 1.98% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.40% 0.40% 0.22% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.50% 0.30% 0.25% 0.00% NA
Temperate Japonica  767 43.30% 53.60% 3.13% 0.00% NA
Tropical Japonica  504 99.20% 0.40% 0.40% 0.00% NA
Japonica Intermediate  241 95.40% 2.90% 1.66% 0.00% NA
VI/Aromatic  96 94.80% 0.00% 5.21% 0.00% NA
Intermediate  90 88.90% 11.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1011696221 A -> T LOC_Os10g22560.1 upstream_gene_variant ; 1182.0bp to feature; MODIFIER silent_mutation Average:36.14; most accessible tissue: Minghui63 panicle, score: 68.46 N N N N
vg1011696221 A -> T LOC_Os10g22560.2 upstream_gene_variant ; 1182.0bp to feature; MODIFIER silent_mutation Average:36.14; most accessible tissue: Minghui63 panicle, score: 68.46 N N N N
vg1011696221 A -> T LOC_Os10g22560.3 upstream_gene_variant ; 1182.0bp to feature; MODIFIER silent_mutation Average:36.14; most accessible tissue: Minghui63 panicle, score: 68.46 N N N N
vg1011696221 A -> T LOC_Os10g22570.1 downstream_gene_variant ; 2771.0bp to feature; MODIFIER silent_mutation Average:36.14; most accessible tissue: Minghui63 panicle, score: 68.46 N N N N
vg1011696221 A -> T LOC_Os10g22560-LOC_Os10g22570 intergenic_region ; MODIFIER silent_mutation Average:36.14; most accessible tissue: Minghui63 panicle, score: 68.46 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1011696221 NA 9.63E-10 Heading_date All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1011696221 NA 9.38E-15 Spikelet_length All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1011696221 NA 5.41E-07 mr1163 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011696221 NA 3.28E-06 mr1330 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011696221 NA 1.68E-09 mr1486 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011696221 NA 6.42E-08 mr1627 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011696221 NA 1.90E-07 mr1763 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011696221 NA 6.17E-06 mr1829 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011696221 8.20E-07 5.89E-13 mr1902 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011696221 NA 1.82E-08 mr1902 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011696221 NA 1.45E-09 mr1010_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011696221 NA 1.59E-06 mr1182_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011696221 NA 9.89E-06 mr1206_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011696221 NA 1.75E-07 mr1229_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011696221 NA 1.02E-06 mr1229_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011696221 NA 4.14E-06 mr1263_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011696221 NA 5.52E-07 mr1263_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011696221 NA 2.72E-06 mr1354_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011696221 NA 1.38E-06 mr1627_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011696221 NA 2.30E-06 mr1763_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011696221 NA 4.67E-09 mr1880_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011696221 NA 6.01E-08 mr1880_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011696221 NA 2.26E-07 mr1902_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251