Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1011081452:

Variant ID: vg1011081452 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 11081452
Reference Allele: T	Alternative Allele: G
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.69, G: 0.31, others allele: 0.00, population size: 222. )

Flanking Sequence (100 bp) in Reference Genome:

AACCACTAGATACATATAGCTAAATCATATATATACGGTCGACCAGCCAATAGTAAAGGTTCAGCAGAAAGTATGTCTACCTTAGTTAGAACCGTCTTAA[T/G]
GATCAACCGTTCTAGCATCACTCAAACATAAGCAACAAATCTATTCTATCAATTAGCATTTGTGAGTTATGAATTTTCCATGTTCTATGTTAGTTATACG

Reverse complement sequence

CGTATAACTAACATAGAACATGGAAAATTCATAACTCACAAATGCTAATTGATAGAATAGATTTGTTGCTTATGTTTGAGTGATGCTAGAACGGTTGATC[A/C]
TTAAGACGGTTCTAACTAAGGTAGACATACTTTCTGCTGAACCTTTACTATTGGCTGGTCGACCGTATATATATGATTTAGCTATATGTATCTAGTGGTT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	70.40%	29.60%	0.02%	0.00%	NA
All Indica	2759	82.10%	17.80%	0.04%	0.00%	NA
All Japonica	1512	42.30%	57.70%	0.00%	0.00%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	68.60%	31.40%	0.00%	0.00%	NA
Indica II	465	95.90%	4.10%	0.00%	0.00%	NA
Indica III	913	83.80%	16.20%	0.00%	0.00%	NA
Indica Intermediate	786	82.30%	17.60%	0.13%	0.00%	NA
Temperate Japonica	767	9.10%	90.90%	0.00%	0.00%	NA
Tropical Japonica	504	92.50%	7.50%	0.00%	0.00%	NA
Japonica Intermediate	241	43.20%	56.80%	0.00%	0.00%	NA
VI/Aromatic	96	91.70%	8.30%	0.00%	0.00%	NA
Intermediate	90	70.00%	30.00%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1011081452	T -> G	LOC_Os10g21630.1	upstream_gene_variant ; 2933.0bp to feature; MODIFIER	silent_mutation	Average:46.937; most accessible tissue: Zhenshan97 young leaf, score: 75.751	N	N	N	N
vg1011081452	T -> G	LOC_Os10g21640.1	downstream_gene_variant ; 2746.0bp to feature; MODIFIER	silent_mutation	Average:46.937; most accessible tissue: Zhenshan97 young leaf, score: 75.751	N	N	N	N
vg1011081452	T -> G	LOC_Os10g21630-LOC_Os10g21640	intergenic_region ; MODIFIER	silent_mutation	Average:46.937; most accessible tissue: Zhenshan97 young leaf, score: 75.751	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1011081452	NA	2.56E-14	Grain_length	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1011081452	NA	1.69E-07	mr1118	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011081452	NA	8.47E-06	mr1123	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011081452	NA	6.45E-08	mr1236	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011081452	NA	1.02E-06	mr1252	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011081452	NA	1.59E-06	mr1300	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011081452	NA	4.34E-09	mr1310	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011081452	NA	3.14E-06	mr1495	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011081452	NA	4.90E-10	mr1580	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011081452	NA	8.16E-10	mr1624	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011081452	NA	3.83E-09	mr1691	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011081452	NA	1.42E-10	mr1693	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011081452	NA	2.23E-06	mr1713	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011081452	NA	1.06E-12	mr1741	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011081452	NA	6.07E-08	mr1825	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011081452	NA	8.70E-07	mr1837	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011081452	NA	8.10E-10	mr1926	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011081452	NA	3.80E-06	mr1118_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011081452	NA	5.51E-09	mr1310_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011081452	NA	1.22E-07	mr1495_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011081452	NA	5.25E-11	mr1533_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011081452	NA	9.71E-07	mr1705_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1011081452	NA	1.39E-06	mr1959_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251