| Variant ID: vg1010710062 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 10710062 |
| Reference Allele: G | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
GGGGGAACCTGATTTTTTTAAGATCTAATGGTTAAAATTATTGGGTCCACCTATTTAAAGAATAATTAATGGTTAGATTTTTTTCTTTTTTATCAGAATT[G/T]
TTATAATTTTTTTTCAAACTTATTAGAGCGCCACATGACGTCTTAAAAGCATTTGTAGAACGTCATGTGGCAGTTTGAGAACGTTTGTAGGGAGTTTAAT
ATTAAACTCCCTACAAACGTTCTCAAACTGCCACATGACGTTCTACAAATGCTTTTAAGACGTCATGTGGCGCTCTAATAAGTTTGAAAAAAAATTATAA[C/A]
AATTCTGATAAAAAAGAAAAAAATCTAACCATTAATTATTCTTTAAATAGGTGGACCCAATAATTTTAACCATTAGATCTTAAAAAAATCAGGTTCCCCC
| Populations | Population Size | Frequency of T(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 87.20% | 3.90% | 0.38% | 8.55% | NA |
| All Indica | 2759 | 96.60% | 0.10% | 0.00% | 3.26% | NA |
| All Japonica | 1512 | 86.90% | 11.80% | 1.06% | 0.26% | NA |
| Aus | 269 | 8.20% | 0.00% | 0.37% | 91.45% | NA |
| Indica I | 595 | 98.00% | 0.20% | 0.00% | 1.85% | NA |
| Indica II | 465 | 99.10% | 0.20% | 0.00% | 0.65% | NA |
| Indica III | 913 | 96.80% | 0.10% | 0.00% | 3.07% | NA |
| Indica Intermediate | 786 | 93.90% | 0.00% | 0.00% | 6.11% | NA |
| Temperate Japonica | 767 | 76.10% | 22.40% | 1.43% | 0.00% | NA |
| Tropical Japonica | 504 | 98.60% | 0.80% | 0.60% | 0.00% | NA |
| Japonica Intermediate | 241 | 96.70% | 0.80% | 0.83% | 1.66% | NA |
| VI/Aromatic | 96 | 45.80% | 0.00% | 0.00% | 54.17% | NA |
| Intermediate | 90 | 82.20% | 3.30% | 1.11% | 13.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1010710062 | G -> T | LOC_Os10g21100.1 | upstream_gene_variant ; 1334.0bp to feature; MODIFIER | silent_mutation | Average:36.37; most accessible tissue: Minghui63 panicle, score: 46.754 | N | N | N | N |
| vg1010710062 | G -> T | LOC_Os10g21090-LOC_Os10g21100 | intergenic_region ; MODIFIER | silent_mutation | Average:36.37; most accessible tissue: Minghui63 panicle, score: 46.754 | N | N | N | N |
| vg1010710062 | G -> DEL | N | N | silent_mutation | Average:36.37; most accessible tissue: Minghui63 panicle, score: 46.754 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1010710062 | NA | 1.98E-10 | Heading_date | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg1010710062 | 2.43E-06 | 3.86E-06 | mr1060_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010710062 | 1.70E-06 | 7.80E-07 | mr1060_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010710062 | 7.92E-06 | 6.40E-06 | mr1332_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010710062 | 8.44E-06 | NA | mr1546_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1010710062 | NA | 5.27E-07 | mr1723_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |