Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1002106147:

Variant ID: vg1002106147 (JBrowse)	Variation Type: SNP
Chromosome: chr10	Position: 2106147
Reference Allele: A	Alternative Allele: T
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.59, T: 0.41, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:

CTCCATTTATCTTGTATGTTTGCATTATGTCAATAATCATTTAATGAGTTAATTATTTGGAACGACATAACGGATTAGCTCATACTAGCCGCCAACCCGG[A/T]
CGTTGCACAAGCTATTACAAGAAATAAAAATATAAAAAAGACCAAATACATTTTATTGCTTAATAATCTAATTGGCATGAGTACAATGGATGTATGAAGA

Reverse complement sequence

TCTTCATACATCCATTGTACTCATGCCAATTAGATTATTAAGCAATAAAATGTATTTGGTCTTTTTTATATTTTTATTTCTTGTAATAGCTTGTGCAACG[T/A]
CCGGGTTGGCGGCTAGTATGAGCTAATCCGTTATGTCGTTCCAAATAATTAACTCATTAAATGATTATTGACATAATGCAAACATACAAGATAAATGGAG

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	41.00%	25.40%	17.58%	16.00%	NA
All Indica	2759	28.10%	15.50%	29.25%	27.11%	NA
All Japonica	1512	60.70%	38.80%	0.26%	0.26%	NA
Aus	269	38.70%	59.50%	1.49%	0.37%	NA
Indica I	595	11.40%	26.90%	41.01%	20.67%	NA
Indica II	465	28.80%	4.10%	32.47%	34.62%	NA
Indica III	913	38.90%	14.00%	18.62%	28.48%	NA
Indica Intermediate	786	27.70%	15.50%	30.79%	25.95%	NA
Temperate Japonica	767	33.90%	65.60%	0.26%	0.26%	NA
Tropical Japonica	504	92.90%	6.90%	0.20%	0.00%	NA
Japonica Intermediate	241	78.80%	19.90%	0.41%	0.83%	NA
VI/Aromatic	96	92.70%	7.30%	0.00%	0.00%	NA
Intermediate	90	60.00%	18.90%	17.78%	3.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1002106147	A -> T	LOC_Os10g04460.1	upstream_gene_variant ; 4515.0bp to feature; MODIFIER	silent_mutation	Average:43.807; most accessible tissue: Minghui63 root, score: 56.226	N	N	N	N
vg1002106147	A -> T	LOC_Os10g04470.1	downstream_gene_variant ; 1609.0bp to feature; MODIFIER	silent_mutation	Average:43.807; most accessible tissue: Minghui63 root, score: 56.226	N	N	N	N
vg1002106147	A -> T	LOC_Os10g04460-LOC_Os10g04470	intergenic_region ; MODIFIER	silent_mutation	Average:43.807; most accessible tissue: Minghui63 root, score: 56.226	N	N	N	N
vg1002106147	A -> DEL	N	N	silent_mutation	Average:43.807; most accessible tissue: Minghui63 root, score: 56.226	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1002106147	NA	1.38E-13	Grain_length	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1002106147	8.39E-06	NA	mr1486	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002106147	4.59E-07	NA	mr1588	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002106147	5.00E-06	2.07E-06	mr1588	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002106147	NA	1.19E-06	mr1709	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002106147	NA	5.53E-09	mr1709_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251