\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1002090270:

Variant ID: vg1002090270 (JBrowse)Variation Type: SNP
Chromosome: chr10Position: 2090270
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTAATCTCTACTATATAAAAGAATCTAGTGAACGTGGTGATGAATCTGCCACCCCCTCGAGTTGGTGGGATCTTCTAAGCCTAGATAAATGGAGTATATC[T/C]
GTGCAGGTGGCTTGGCCTTTTTTTTTTTGGATATTTGCTTGCAAATTTTATATTCTAATAAGTATATATTTTCAAGTTAAGAACTTACAATATATATTTT

Reverse complement sequence

AAAATATATATTGTAAGTTCTTAACTTGAAAATATATACTTATTAGAATATAAAATTTGCAAGCAAATATCCAAAAAAAAAAAGGCCAAGCCACCTGCAC[A/G]
GATATACTCCATTTATCTAGGCTTAGAAGATCCCACCAACTCGAGGGGGTGGCAGATTCATCACCACGTTCACTAGATTCTTTTATATAGTAGAGATTAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 55.60% 44.20% 0.13% 0.00% NA
All Indica  2759 86.50% 13.30% 0.18% 0.00% NA
All Japonica  1512 2.80% 97.20% 0.00% 0.00% NA
Aus  269 61.00% 39.00% 0.00% 0.00% NA
Indica I  595 98.00% 1.70% 0.34% 0.00% NA
Indica II  465 92.30% 7.50% 0.22% 0.00% NA
Indica III  913 76.50% 23.50% 0.00% 0.00% NA
Indica Intermediate  786 86.10% 13.60% 0.25% 0.00% NA
Temperate Japonica  767 0.80% 99.20% 0.00% 0.00% NA
Tropical Japonica  504 6.30% 93.70% 0.00% 0.00% NA
Japonica Intermediate  241 1.70% 98.30% 0.00% 0.00% NA
VI/Aromatic  96 7.30% 92.70% 0.00% 0.00% NA
Intermediate  90 33.30% 65.60% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1002090270 T -> C LOC_Os10g04410.1 downstream_gene_variant ; 3449.0bp to feature; MODIFIER silent_mutation Average:78.696; most accessible tissue: Callus, score: 94.855 N N N N
vg1002090270 T -> C LOC_Os10g04429.1 intron_variant ; MODIFIER silent_mutation Average:78.696; most accessible tissue: Callus, score: 94.855 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1002090270 T C -0.01 0.0 -0.01 0.0 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1002090270 NA 7.35E-23 Yield All YES Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1002090270 NA 7.05E-09 mr1198 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002090270 NA 4.20E-08 mr1249 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002090270 NA 5.74E-06 mr1832 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1002090270 NA 6.50E-16 mr1940 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251