\
| Variant ID: vg1002049704 (JBrowse) | Variation Type: SNP |
| Chromosome: chr10 | Position: 2049704 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
GTCACTTTGGAGGATTTGAACGAGGAACAACGCCAAGAGATAGAATGACATATGAAGGCGACACAAGAGGTGCTTTTGGCGGGATGCTTCGTCAAGACTC[A/G]
TTAAGGAGTTACTCGAAAGCCTGACCCAATGCCCCGTGTCGTTGTTAATGAGGTAAGCATTGCTGACATTGCTCTTTAGCATATTCCGTACATGAATCCG
CGGATTCATGTACGGAATATGCTAAAGAGCAATGTCAGCAATGCTTACCTCATTAACAACGACACGGGGCATTGGGTCAGGCTTTCGAGTAACTCCTTAA[T/C]
GAGTCTTGACGAAGCATCCCGCCAAAAGCACCTCTTGTGTCGCCTTCATATGTCATTCTATCTCTTGGCGTTGTTCCTCGTTCAAATCCTCCAAAGTGAC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 49.90% | 36.20% | 0.32% | 13.65% | NA |
| All Indica | 2759 | 75.20% | 4.00% | 0.54% | 20.26% | NA |
| All Japonica | 1512 | 3.70% | 96.20% | 0.00% | 0.07% | NA |
| Aus | 269 | 66.90% | 3.30% | 0.00% | 29.74% | NA |
| Indica I | 595 | 56.10% | 3.40% | 0.67% | 39.83% | NA |
| Indica II | 465 | 80.20% | 4.10% | 0.86% | 14.84% | NA |
| Indica III | 913 | 83.90% | 2.50% | 0.11% | 13.47% | NA |
| Indica Intermediate | 786 | 76.50% | 6.20% | 0.76% | 16.54% | NA |
| Temperate Japonica | 767 | 1.60% | 98.40% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 7.10% | 92.90% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 3.30% | 96.30% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 8.30% | 91.70% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 42.20% | 52.20% | 0.00% | 5.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1002049704 | A -> G | LOC_Os10g04342.1 | intron_variant ; MODIFIER | silent_mutation | Average:40.369; most accessible tissue: Minghui63 flag leaf, score: 72.028 | N | N | N | N |
| vg1002049704 | A -> DEL | N | N | silent_mutation | Average:40.369; most accessible tissue: Minghui63 flag leaf, score: 72.028 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1002049704 | NA | 4.02E-20 | Yield | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg1002049704 | NA | 4.78E-10 | mr1128 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002049704 | NA | 4.23E-06 | mr1209 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002049704 | NA | 6.22E-06 | mr1215 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002049704 | NA | 4.30E-07 | mr1220 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002049704 | NA | 1.63E-10 | mr1302 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002049704 | NA | 1.38E-10 | mr1307 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002049704 | NA | 4.35E-08 | mr1315 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002049704 | NA | 2.11E-09 | mr1322 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002049704 | NA | 9.53E-18 | mr1323 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002049704 | 9.69E-06 | 9.68E-06 | mr1323 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002049704 | NA | 1.02E-09 | mr1332 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002049704 | NA | 5.03E-06 | mr1374 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002049704 | NA | 1.95E-08 | mr1392 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002049704 | NA | 1.08E-06 | mr1418 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002049704 | NA | 6.51E-07 | mr1420 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002049704 | NA | 6.69E-10 | mr1488 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002049704 | NA | 1.48E-08 | mr1506 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002049704 | NA | 8.97E-06 | mr1507 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002049704 | NA | 5.09E-06 | mr1508 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002049704 | NA | 6.19E-06 | mr1516 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002049704 | NA | 1.01E-09 | mr1604 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002049704 | NA | 3.64E-12 | mr1636 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002049704 | NA | 6.70E-07 | mr1646 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002049704 | NA | 2.22E-11 | mr1683 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002049704 | NA | 8.15E-11 | mr1775 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002049704 | NA | 9.72E-12 | mr1776 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002049704 | NA | 1.48E-07 | mr1779 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002049704 | NA | 5.52E-07 | mr1797 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002049704 | NA | 5.52E-07 | mr1801 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002049704 | NA | 3.66E-08 | mr1810 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002049704 | NA | 1.78E-07 | mr1824 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002049704 | NA | 1.46E-20 | mr1838 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002049704 | NA | 4.72E-22 | mr1839 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002049704 | NA | 6.10E-07 | mr1886 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1002049704 | NA | 9.05E-15 | mr1909 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |